cascade offered by bis 7 cognitin a novel anti alzheimer apos s dimer

Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

Báo cáo Y học: Repression of FasL expression by retinoic acid involves a novel mechanism of inhibition of transactivation function of the nuclear factors of activated T-cells pptx

Ngày tải lên : 24/03/2014, 03:21
... one-way analysis of variance was performed using GraphPad INSTATÒ (GraphPad Software, San Diego, CA, USA) A value of P < 0.05 was considered statistically significant Electrophoretic mobility shift ... treatment in a dose-dependent manner (Fig 1A) FasL transcription was decreased at all-trans-RA concentrations as low as 0.01 lM, and was almost completely abolished at 1.0 lM To further establish the ... As shown in Fig 5B, the repression of NFAT– DNA binding by all-trans-RA was dose-dependent; the repression was observed with all-trans-RA concentrations as low as 0.1 lM, and NFAT binding was...
  • 9
  • 481
  • 0
Báo cáo y học: "Expression of infectious murine leukemia viruses by RAW264.7 cells, a potential complication for studies with a widely used mouse macrophage cell line" ppsx

Báo cáo y học: "Expression of infectious murine leukemia viruses by RAW264.7 cells, a potential complication for studies with a widely used mouse macrophage cell line" ppsx

Ngày tải lên : 13/08/2014, 06:20
... Carpinteria, CA Catalog # A4 52), and anti- PAX5 for B-cell lineage (Goat anti- Pax 5, Santa Cruz Biotechnology, Santa Cruz, CA, Catalog #sc-1 974 ) [14] Criteria for histopathological diagnosis were as described ... This work was supported in part by the Intramural Research Program of the National Institutes of Health, National Institute of Allergy and Infectious Diseases and Divisions of Research Services, ... Negative results with mAbs reactive with xenotropic MuLVs indicated no significant population of this class in RAW264 .7 supernatants (data not shown) Thus, RAW264 .7 cells express approximately...
  • 6
  • 330
  • 0
Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx

Báo cáo khoa học: NARG2 encodes a novel nuclear protein with (S/T)PXX motifs that is expressed during development docx

Ngày tải lên : 23/03/2014, 13:20
... gt atgt … tcca ag ATGCCC AAGGAC gt aagt … ttca ag GATTGC AGAAGA gt aagt … ttgc ag CAATTT ATGTTG gt gagt … tttt ag GGCATA ACTCAA gt aagg … taat ag GATTTC ATGTAG gt aagt … atgc ag CTTGCA GCAAAG ... AAAATT GCATTG gt aagg … attt ag GGCAGT CATTAT gt aagt … tttc ag GATATT TTGCAG gt ttgt … ttta ag GTTCAA ATGGAC gt atgt … cata ag ATGTCC AAGGAC gt aagt … ttaa ag GATTGC AGAAGA gt aagt … ttgc ag ... 176 130 85 51 259 >640 CATGAG gt gggc … actc ag CTGAGT a 3¢ boundary GAATTG gt gagt … tcac ag GGATAT CAACAG gt aata … ttcc ag ACGTAT TACTTG gt atgt … aatc ag GATATG ACAGAG gt aaaa … tctc ag AAAATT...
  • 9
  • 470
  • 0
Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx

Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx

Ngày tải lên : 09/08/2014, 08:22
... sclerosis (SSc), various forms of primary vasculitis as well as in patients with diseases that share clinical features with BD, such as inflammatory bowel disease and uveitis Finally, we evaluated ... boxy-terminal subunit of Sip1 (anti- Sip1 C-ter) antibodies in patients with Behçet 's disease (BD), systemic lupus erythematosus (SLE), systemic sclerosis (SSc), vasculitis, inflammatory bowel disease ... coordination and drafted the manuscript All authors read and approved the final manuscript Acknowledgements We thank Professor Francesco Vecchi for assistance with statistical analysis This work was...
  • 8
  • 550
  • 0
Báo cáo y học: "A novel nucleotide insertion in S gene of hepatitis B virus in a chronic carrier" pps

Báo cáo y học: "A novel nucleotide insertion in S gene of hepatitis B virus in a chronic carrier" pps

Ngày tải lên : 12/08/2014, 04:20
... between aa123 and aa124 [16], 1-aa insertion between aa121 and aa122 [20], 3-aa insertion between aa118 and aa119 [18], 2-aa deletion from aa110 to aa111 [ 17] , 4-aa deletion from aa119 to aa122 [ 17] , ... Nomenclature for antiviral-resistant human hepatitis B virus mutations in the polymerase region Hepatology 2001, 33 :75 1 -75 7 Alexopoulou A, Baltayiannis G, Jammeh S, Waters J, Dourakis SP, Karayiannis ... Grethe S, Monazahian M, Bohme I, Thomssen R: Characterization of unusual escape variants of hepatitis B virus isolated from a hepatitis B surface antigen-negative subject J Virol 1998, 72 :76 92 -76 96...
  • 5
  • 381
  • 0
Báo cáo khoa học: "Identification and characterisation of a novel anti-viral peptide against avian influenza virus H9N" pps

Báo cáo khoa học: "Identification and characterisation of a novel anti-viral peptide against avian influenza virus H9N" pps

Ngày tải lên : 12/08/2014, 04:21
... CATAGAATTCGCAAAAGCAGGAGT 3' 5' TATCGCTCGAGAGTAGAAACAAGGAG 3' 5' ATTTAAGGTACCGACAGCCATGGA 3' 5' ATGCTGCTCGAGTATACAAATGTTGC 3' 5' AGCCTGGAATTCATGAAAAAATTA 3' 5' ATCGAACTCGAGATTTTCAGGGAT 3' 5' AGGGCTGGCGGTTGGGGGTTATTCGC ... AGGGCTGGCGGTTGGGGGTTATTCGC 3' 5' GAGTCACTTTAAAATTTGTATACAC 3' 5' GATGTTAACGATACCAGCC 3' 5' GCGTGAATGTAAGCGTGAC 3' 5'ATTTAAGGATCCGAGAGCCATGGA 3' 5'ATGCTGCTCGAGTTATATACAAATGTTGC 3' 5'CATAGAATTCGCAAAAGCAGGAGT 3' ... 3' 5'TATCGCTCGAGAGTAGAAACAAGGAG 3' 5'AGCCTGGAATTCATGAAAAAATTA 3' 5'CTCACTCGAGACATTTTCAGGGA 3' aIn all of the above mentioned oligonucleotides, the suffixes F and R refers Forward and Reverse primers...
  • 12
  • 288
  • 0
Báo cáo khoa học: " A novel b-glucan produced by Paenibacillus polymyxa JB115 induces nitric oxide production in RAW264.7 macrophages" docx

Báo cáo khoa học: " A novel b-glucan produced by Paenibacillus polymyxa JB115 induces nitric oxide production in RAW264.7 macrophages" docx

Ngày tải lên : 07/08/2014, 23:22
... βglucan at various concentrations, or LPS After an h incubation, i-NOS, COX-2, IL-6 and TNF-α mRNA were assessed by semiquantitative RT-PCR Acknowledgments This study was supported in part by the ... Gordon S, Williams DL Oral delivery and gastrointestinal absorption of soluble glucans stimulate increased resistance to infectious challenge J Pharmacol Exp Ther 2005, 314, 1 079 -1086 17 Ross GD, ... Zhi-Qiang Chang et al Fig Effects of β-glucan and lipopolysaccharide (LPS) on the viability of RAW264 .7 macrophages Data represents the mean ± SD *Significant difference (p < 0.05) compared to...
  • 3
  • 281
  • 0
Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

Ngày tải lên : 19/02/2014, 16:20
... that MABO also exhibits sarcosine oxidase activity, may indicate an evolutionary relationship to sarcosine oxidases, enzymes largely distributed among soil bacteria MABO may have evolved from a ... dehydrogenases and oxidases Indeed, when the protein was tested on native polyacrylamide gels in a peroxidase-coupled assay with c-N-methylaminobutyrate as the substrate, a characteristic colour ... proteins on Ni-chelating Sepharose, as described by the supplier of the Sepharose (Amersham Biosciences, Freiburg, Germany) The isolated protein was analysed by SDS/PAGE on 10% (w/v) polyacrylamide...
  • 8
  • 647
  • 0
Tài liệu THE ENTITLED A novel by Frank Deford doc

Tài liệu THE ENTITLED A novel by Frank Deford doc

Ngày tải lên : 21/02/2014, 06:20
... aren’t I, Amo?” “You got it.” “And the other manager is too easy They call him a ‘players’ manager.’ Only as soon as his team starts to lose, the papers say that the team is starting to get away ... the Jesus-this/Jesus-that guys, but Amo doesn’t fake that crap.” “That s what I’ve heard,” Howie said He was pleased that Alcazar appeared to like Willis It was nice that the young star approved ... need? What were they going to do, talk about signs for the double steal? So, after a late breakfast that day, Alcazar walked Ashley out to her car Her s was a sunshine yellow Saab convertible Ashley...
  • 294
  • 295
  • 0
Báo cáo khoa học: A novel ErbB2 epitope targeted by human antitumor immunoagents ppt

Báo cáo khoa học: A novel ErbB2 epitope targeted by human antitumor immunoagents ppt

Ngày tải lên : 06/03/2014, 00:21
... (HRP)-conjugated antibody against His (Qiagen, Valencia, CA, USA), and HRP-conjugated goat anti- [human (affinity-isolated) IgG1] (Fc-specific) (Sigma, St Louis, MO, USA) Erb-hcAb was prepared as previously ... curves represent a summary of at least three determinations Standard deviations were below 10% by Glu (SRASEPSSPMSKGS) was synthesized and tested as described above Furthermore, an unrelated ... for her skilled assistance This work was financially supported by AIRC (Associazione Italiana per la Ricerca sul Cancro), Italy, MUR ` (Ministero dell’Universita e della Ricerca), Italy, and Biotecnol,...
  • 11
  • 373
  • 0
Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

Ngày tải lên : 07/03/2014, 04:20
... S1 3 3A, S1 3 3A ⁄ S1 3 4A and S1 34D mutagenized forms of GRX4 as described previously, using, respectively, the S1 3 4A- S ⁄ S1 3 4A- AS, S1 3 3A- S ⁄ S1 3 3A- AS, S1 3 3A- S1 34AS ⁄ S1 3 3A- S1 3 4A- AS and S1 34D -S ⁄ S1 34D-AS ... chemiluminescence (Amersham ⁄ GE Healthcare Ltd, Chalfont St Giles, UK), and the signal was quantified on a Kodak Image Station 440CF and analyzed with Kodak 1d image software Monoclonal antibodies against ... wild-type activity, similarly to what was seen with the K5 2A and D16 1A mutants The observation that Grx4p phosphorylation was comparable in both mutant strains (bud32 -S2 5 8A and sch9D, lanes and 3, respectively)...
  • 15
  • 414
  • 0
Báo cáo khoa học: A novel metallobridged bis(b-cyclodextrin)s fluorescent probe for the determination of glutathione doc

Báo cáo khoa học: A novel metallobridged bis(b-cyclodextrin)s fluorescent probe for the determination of glutathione doc

Ngày tải lên : 07/03/2014, 05:20
... elemental analysis was performed on Perkin-Elmer Series P CHNS O analyzer pH measurements was made with a pHS3 digital pH meter (Shanghai Lei Ci Device Works, Shanghai, China) with a combined glass-calomel ... the plasma constituents The proposed method was successfully used to determine GSH in human plasma Experimental procedures Apparatus and reagents All spectrouorimetric measurements were carried ... GSH in plasma are satisfactory Conclusions We synthesized a novel metallobridged bis( b-CD )s 2, which afforded two hydrophobic binding sites cooperatively associating with the guest GSH and also...
  • 8
  • 429
  • 0
Báo cáo khoa học: Enhanced peptide secretion by gene disruption of CYM1, a novel protease in Saccharomyces cerevisiae doc

Báo cáo khoa học: Enhanced peptide secretion by gene disruption of CYM1, a novel protease in Saccharomyces cerevisiae doc

Ngày tải lên : 07/03/2014, 16:20
... Y15 370 10864B Y1 174 9 Y16248 10231B Y14266 LJY430 LJY431 LJY432 MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa ... examined with a Zeiss LSM 510 confocal laser scanning microscope Statistical analysis Statistical calculations were performed using an unpaired students t-test to analyse whether the change in peptide ... enzymes [5] Our data indicates that yeast contain a metalloprotease, which could be a novel a- secretase, in addition to the two aspartic proteases, Yps1 and Yps2 None of the yeast metalloproteases...
  • 10
  • 631
  • 0
Family - a novel by Tom Lyons pdf

Family - a novel by Tom Lyons pdf

Ngày tải lên : 14/03/2014, 10:20
... Navy warships as I left my house that morning; the battleship USS California which was sunk by Japanese torpedoes at Pearl Harbor and the battleship USS Alabama with its 16 inch guns capable of ... have made her a young teenager when the last Russian Czar, Nicolas II, and his wife, son, and four daughters, were assassinated in 19 17 When she spoke there was no trace of an accent -I was a dancer, ... United States to attend college at Stanford She was studying to be a medical doctor What her parent s really wanted was to get her as far away from the Nazis as possible; Helen s parents owned a tailoring...
  • 40
  • 363
  • 0
Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exemplified by a novel neuronal protein, CASK-interactive protein1 pot

Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exemplified by a novel neuronal protein, CASK-interactive protein1 pot

Ngày tải lên : 16/03/2014, 02:20
... example, the Shank proteins serve as important scaffold molecules modulating signalling pathways at the post-synaptic sites of brain excitatory synapses [36] Ste5 serves in the yeast mating pathway, ... cytoskeletal proteins, G-proteins and their modulators, and signalling molecules including kinases and phosphatases [ 47] A variety of scaffold proteins, such as members of the MAGUK, Shank and ... pathway, ensuring that components of the mitogen-activated protein kinase (MAPK) cascade, also involved in osmoresponse and filamentation pathways, act specifically [18] In our case, Caskin1 has been...
  • 13
  • 408
  • 0
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

Ngày tải lên : 16/03/2014, 06:20
... GCGAAGCTTCGGCCTAGCTCTCTCCCGGGTCTC GCGGGTACCAATGTGATGGGTGGACTGGT GCGAAGCTTACCAGACCGTGGACTAACGA CCCACCGTCTTCGAGAACTA CTTCCTTGGTCTTGGCAGAG CCAGACTAGATGTAGTATTTTTTG ATTAGAGCCAGATGCTTAAGTCC ACCACAGTCCATGCCATCAC ... adenoviruses expressing Smad3 (or LacZ as a negative control), and assessed the polymerization dynamics of the actin cytoskeleton by quantita- Fig Smad2 and Smad3 induce actin reorganization in Swiss ... efficiency was performed by b-galactosidase assays Plasmids The mammalian vectors expressing Smad2, Smad3 and the constitutively active form of ALK5 were a kind gift from A Moustakas (Ludwig Institute...
  • 14
  • 420
  • 0
Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf

Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf

Ngày tải lên : 16/03/2014, 11:20
... images were analyzed using image-pro plus 4.5 software Materials o-Aminobenzenothiol was purchased from Fluka (Shanghai, China) A stock solution (1 mm) of DBZTC (synthesized in-house) was prepared ... (2000) Seasonal variation in antioxidants of Polygonum viviparum and its relation to solar radiation in alpine meadow Acta Bot Boreal Occident Sin 20, 201–205 Chaudhury S & Sarkar PK (1983) Stimulation ... measurement As can be seen from Fig 6, fluorescence intensity was markedly suppressed by addition of SOD However, when SOD was replaced by heat-inactivated SOD (90 °C for min) [18] or catalase,...
  • 9
  • 401
  • 0
By the Light of the SoulMary Eleanor Wilkins-Freeman..By the Light of the Soul A Novel By Mary E. Wilkins Freeman Author of “The Debtor” “The Portion of Labor” “Jerome” “A New England Nun” Etc. etc.1907To Harriet and Carolyn Alden..By the Light o pptx

By the Light of the SoulMary Eleanor Wilkins-Freeman..By the Light of the Soul A Novel By Mary E. Wilkins Freeman Author of “The Debtor” “The Portion of Labor” “Jerome” “A New England Nun” Etc. etc.1907To Harriet and Carolyn Alden..By the Light o pptx

Ngày tải lên : 16/03/2014, 18:20
... enough, and she knows it,” said they She was in the high school, even at her age, and she stood high in her classes There was always a sort of moral strike going on against Maria, as there is against ... disguised the fact She was very useful His meals were always on time, the house was as neatly kept as before, and Maria was being trained as she had never been in household duties Maria was obedient, ... ruffles at her slender shoulders at Wollaston Lee He was gazing straight at Miss Slome, Miss Ida Slome, who was the schoolteacher, and his young face wore an expression of devotion Maria s By the...
  • 488
  • 398
  • 0
A novel by Antony E Bradbury pdf

A novel by Antony E Bradbury pdf

Ngày tải lên : 17/03/2014, 23:20
... plaits He glanced up at Charles, and saw the old man smiling at him, almost embarrassed "It contains a lock from each of the girls, along with those of Maria and Thora." Charles said as he rested ... glanced across at Maria; he knew that she was strong and philosophical He saw her gazing deeply into Alan 's eyes and saw the longing and deep melancholy Philippe watched as Maria embraced Alan ... immense learning He was grateful that the ale was only affecting his legs and not his thought processes Cecil leaned back against his chair; his hands prayer-like to his nose as he gave his full attention...
  • 255
  • 377
  • 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Ngày tải lên : 23/03/2014, 13:20
... GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC Nested pair ATGTGGCTGCATGGGACGTG TCTGCAGGGTCACGGAGATG Exon Exon ... photodiode array detector (SPD-M10Avp) and quadrupole mass spectrometer The LC/MS workstation CLASS-8000 software was used for system control and data acquisition (Shimadzu) Elution was carried out isocratically ... The loss of mass 131 results from the scission of the C1–C2 and C4–C5 bonds Figure 4C illustrates mass spectra of isolated 7- DHP-MO-TMS, and the synthesized standard The molecular ion is at m/z...
  • 11
  • 475
  • 0

Xem thêm