carrying out a photochemical reaction

... Summary Comparision between free radical and cationic polymerization Property Radical Cationic Reaction rate high Moderate/high Initiator by light Light and heat Volume change large negligible adhesion ... Iodonium  Ex: Cationic Photocrosslinking • Be bonds that link one polymer chain to another • Can be formed by chemical reactions that are initiated by radiation • Change physical properties of ... Crosslinking by dichromate Photodegradation   Be degradation of a photodegradable molecule caused by the absorption of photons (light) Ex: photodegradation of diazonium salt N2Cl N2X O H X hv...

Ngày tải lên: 14/03/2014, 15:20

... class of enzymes, we assayed Toxoplasma gondii FNR [11], Plasmodium falciparum FNR [12] and spinach (Spinacia oleracea) leaf FNR [13] (which all are planttype FNRs) for their ability to catalyze ... the NADP+ oxidation reaction is highly regiospecific Kinetics of NADPO formation as catalyzed by FprA and AdR Figure 4A shows the time courses of NADP+ oxidation to NADPO catalyzed by FprA or AdR ... the reaction rate When FprA was the catalyst, this behavior was particularly marked: NADPO formation sharply decreased after the first enzyme turnover We excluded the possibility that this was a...

Ngày tải lên: 16/03/2014, 11:20

... Human Language Technology and Empirical Methods in Natural Language Processing (HLT’05), pages 883–890, Vancouver, British Columbia, Canada Antonio Toral, Stefania Bracale, Monica Monachini, and ... International Conference on Language Resources and Evaluation (LREC), pages 43–47, Valletta, Malta Susan Windisch Brown, Dmitriy Dligach, and Martha Palmer 2011 VerbNet Class Assignment as a WSD Task ... Applications, pages 111–125, Berlin Heidelberg Springer-Verlag Aljoscha Burchardt, Katrin Erk, Anette Frank, Andrea Kowalski, Sebastian Pad´ , and Manfred Pinkal o 2006 The SALSA Corpus: a German...

Ngày tải lên: 17/03/2014, 22:20

... International Conference Center, Lusaka, Zambia; 2007 Kombe G: Human Resources for Health challenges in dealing with HIV/AIDS in Sub-Saharan Africa In Pan American Health Organization, World Health ... year to year There may also be a negative impact on long-term quality of care if top-ups are withdrawn after a year, and this underlines concerns about sustainability of the programmes An advisor ... directorate alongside a clinical care specialist employed by the Ministry of Health, but receive a higher salary While part of the provincial health team, they also have access to a small operational...

Ngày tải lên: 18/06/2014, 17:20

... intercept and an environment deviating SD when the variance in the slope was small (a small variance ratio, little G × E), but a larger influence with a larger variance in the slope (larger variance ratio, ... individuals of the same litter The slope of a linear reaction norm is a measure of sensitivity towards environmental change, which can be treated as a trait of the animal [8] Genetic variation ... breeding and environmental values are expressed as deviations from the average reaction norm As is common in animal breeding, covariances between residuals of different individuals and covariances...

Ngày tải lên: 14/08/2014, 13:22

... phase transfer catalysis that must be analysed Phase transfer reactions may be classified according to two major categories13: Reactions involving anions that are available as salts, for example ... numerous catalysts are available today These catalysts may be classified according to various criteria: structure, area of application, state of aggregation or composition5 One area of catalysis ... Transfer Catalysis Phase transfer catalysis refers to the ability of a catalytic amount of transfer agents to accelerate chemical reaction between reagents located in different phases of a reaction...

Ngày tải lên: 13/10/2015, 15:57

... long reaction times and additionally stringent conditions like high temperatures Using the catalytically accelerated reaction variant introduced by Sharpless, only few hours at room temperature are ... quantitative reaction rate, 3) the potential for selective multiple reactions at the identical molecule, 4) the easy monitoring of the chemical reaction and 5) the feasibility of the reaction at ... al Polytriazoles as copper(I)-stabilizing ligands in catalysis Organic Letters 2004; 6: 2853-5 Bock VD, Hiemstra H, van Maarseveen JH Cu-I-catalyzed alkyne-azide "click" cycloadditions from a...

Ngày tải lên: 26/10/2012, 09:39

... would be proprietary in nature and very limited data are available in the open literature There are several reasons that make the tubular design more advantageous than the planar one for medium ... reaction propagates at the rate demanded by the current The activation overpotential can be divided into the anode and cathode overpotentials The anode and cathode activation overpotentials are ... molar oxygen fraction at the catalyst layer At a tubular shape, the oxygen mole fraction variation is low enough not to cause diffusive limitations, whereas at a planar shape the concentration...

Ngày tải lên: 05/09/2013, 14:58

... book Ask and answer What is she doing? She is driving her car Ask and answer What are they doing? They are driving a car Ask and answer What is he doing? He is riding his motorbike Ask and answer ... What are they doing? They are ing… What are you doing? I am ing… What is he doing? He is driving his car Thur.Dec 2nd, 2010 Lesson 1: What are you doing? (A1 -3) Team A Team B start 10 What are ... Ask and answer What is he doing? He is riding his bike What is she doing? She is waiting for a train Ask and answer What is he doing? He is watching Tv Ask and answer What is he doing? He is reading...

Ngày tải lên: 23/10/2013, 08:11

... Sam ran into Katie, who threw her arms around him and whispered that they needed to talk; she’d heard he was dating someone and wanted to know all about it After hearing about Cara, Katie badmouthed ... met Cara at his coed dodgeball tournament She was pretty and nice and seemed to like him back They started dating and things were going well At a party soon after Sam and Cara started seeing each ... 43 James sends Tiana an Internet video of a cat wearing mittens and sliding all over the kitchen floor Tiana responds with a video of a Maltipoo in a teacup P.M Tiana’s cubicle mate, Laura, asks...

Ngày tải lên: 10/02/2014, 18:17

... 46-69 54.6 DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 DiagN1R GCATCAGGATAACAGGAGCA 794-775 55.4 Kích thước 154 bp 371 bp 292 bp Tối ưu phản ứng mutiplex ... Influenza, 12th edn Ames, IA: Blackwell Publishing Professional 46 Takano R, Nidom CA, Kiso M, Muramoto Y, Yamada S, Sakai-Tagawa Y, Macken C, Kawaoka Y (2009), “Phylogenetic characterization of ... H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential”, Avian Diseases, 40: 425437 45 Swayne DE and Halverson DA (2007), Diseases...

Ngày tải lên: 10/02/2014, 20:39

... the accessible surface area of a monomer contributes to LlPDH dimer formation Whereas LlPDH and OaPDH have a ˚ buried surface area of  5500 A2 , TbPDH has a larger ˚ interface surface area of ... over a mammalian PDH [16–18] In particular 4-phospho-derythronohydroxamic acid (PEX; Fig 1B) has a Ki of 0.01 lm against TbPDH, which is 250 times more potent against the parasite enzyme than against ... domain II, the helical domain Two large helices a8 and a1 4, antiparallel to each other, form the core of this domain and they are enclosed on either side by a set of four helices (a9 – a1 0 a1 6 a1 7)...

Ngày tải lên: 19/02/2014, 05:20

... (Stratagene), based on linear PCR, using the following mutagenic oligonucleotides: 5¢-CGCGATGTATGCGC TCAAGATCCTCGTGGCC-3¢ and 5¢-GGCCACGAGG ATCTTGAGCGCATACATCGCG-3¢ The mutation introduced an additional ... place of the atpBEXF genes (subunits a, c, b¢, b) leaving only a C-terminal truncated atpI gene (subunit i) After GTA transfer, kanamycin-resistant colonies appeared that could contain the kanamycin ... Velours, Bordeaux), the luminol assay for detection, and a purified ATP synthase (isolated from Rb capsulatus as described previously [34]) as a standard The amounts of chromatophores and standard protein...

Ngày tải lên: 21/02/2014, 03:20

... cytochrome c oxidase from Paracoccus denitrificans Nature 376, 660–669 Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R & Yoshikawa, S (1995) ... mbar residual pressure The sample containment, maintained at °C, was purged with dry air to minimize absorbance by water vapor A water-cooled globar was used as source of radiation, which was ... metal sites of oxidized bovine ˚ heart cytochrome c oxidase at 2.8 A Science 269, 1069–1074 Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima,...

Ngày tải lên: 21/02/2014, 15:20

... smear negative cases that were only radiologically positive This aspect has great potential in the laboratory diagnosis of tuberculosis, particularly in paucibacillary cases However, its overall ... with saliva All the samples were processed for bacteriological investigations, namely smear, culture and PCR Sample processing, culture and PCR KAVITA MODI – PAREKH ET AL weeks Characterization ... Characterization of Mycobacteria was done at the Corporation laboratory by primary differential tests for atypical Mycobacteria Statistical analysis 71 tuberculosis) were examined by smear microscopy,...

Ngày tải lên: 06/03/2014, 04:20

... 10S apparatus (Amersham Pharmacia Biotech, Uppsala, Sweden) at C in all steps The cell-free extract after ultracentrifugation (110 000 g) was applied onto HiTrapQ HR5/5 anion exchange column (Amersham ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel ... 15 (B) Autoradiograph of TLC Lane 1, [a- 32P]ATP; lane 2, [a- 32P]ATP treated with hexokinase and glucose; lane 3; sample from lane after incubation with phosphorylated Cl-ACL (AB-p) for 15 at 30...

Ngày tải lên: 08/03/2014, 22:20

... in Alaska, Hawaii, and the U.S Virgin Islands), but are otherwise standard; (iii) Alt -A mortgages not conform to the Fannie Mae and Freddie Mac definitions, perhaps because a mortgagee has a higher ... of accounting as much as regulation Since 1998 the Financial Accounting Standards Board (FASB) in the U.S Statement of Financial Accounting Standard (SFAS) No 133, has required fair value accounting ... re-regulate financial markets is enhanced by the fact that central banks, backed by governments, provide an insurance against liquidity risks Such insurance inevitably leads to moral hazard and excessive...

Ngày tải lên: 15/03/2014, 07:20

... lnðaaÞ þ ln t þ a a aa ð3Þ or it can be simplified as (if t ) 1=aa): S¼ 1 lnðaaÞ þ ln t a a ð4Þ where S is the amount of adsorbate adsorbed per unit mass of adsorbent (mg/kg) at time t while a and ... initial stages of contact and reached a maximum in the range of 35–60 for soil minerals such as hematite and feldspar Carbonell Barrachina et al (1996) observed that 80% of the total amount of As(III) ... soil was very acidic with pH values of about 4.5 for a soil:water ratio of 1:1 and about 4.7 for a soil:water ratio of 1:20 The parent material, weathering processes, and absence of carbonate content...

Ngày tải lên: 16/03/2014, 00:25

... Fig 1a and b show TEM images of the SiNWs Which indicates the product consists of clusters of high aspect ratio nanowires In Fig 1a, we can see a typical nanowire bundle that has a diameter around ... boundary The bending character of SiNWs (Fig 1a, b) may be caused by the crystalline defects like stacking faults or twins In previous reports, metal-catalyzed (such as Au) SiNWs growth was explained ... Education Ministry (NCET-04-0561), the National High Technology Research and Development Program of China (No 2007AA03Z301), the National Natural Science Foundation of China (No 20771032), the National...

Ngày tải lên: 16/03/2014, 15:10

... peroxide was inferred from an increase in catalytic current upon addition of catalase b As hydrogen peroxide from reaction (a) inactivated the enzyme, oxygenated product from reaction (b) accumulated ... by MMOH and MMOB when absorbed to an electrode surface, via a reaction that may involve hydrogen peroxide as an important intermediate Conformational changes in MMOH induced by MMOB appear to be ... in materials and methods), no such products were observed However, when catalase was added to 50 lM, then product (methanol or cyanoaldehyde) was readily observed by gas chromatography that was...

Ngày tải lên: 17/03/2014, 09:20