cancer stem cells current concepts and therapeutic implications
báo cáo khoa học: "A nano-view of West Nile virus-induced cellular changes during infection" pps
... preparation and AFM studies NML conceived of the study, and participated in its design and coordination Both authors read and approved the final manuscript Publish with Bio Med Central and every ... Sakzewski Virus Research Laboratory, Queensland, Australia), was propagated in Vero cells throughout this study Flavivirus infection of cells The Vero cells were infected with West Nile (Sarafend) ... selected times p.i., Vero cells infected with WNV were washed twice with cold PBS and fixed with 0.2% glutaraldehyde/ % paraformaldehyde for 30 The cells were scraped and spun down The cell pellet...
- 7
- 188
- 0
Tài liệu Báo cáo khoa học: The capsid protein of human immunodeficiency virus: intersubunit interactions during virus assembly doc
... are small, globular and mainly helical NTD contains a-helices 1–7 of CA, and is connected by a flexible linker to CTD, which contains a small 310-helix, an extended strand and a-helices 8–11 of ... MHR); and (c) NTD residues participate to some extent in intrahexamer and ⁄ or inter-hexamer interactions (Fig 1) 6100 This model remains to be validated and extended to higher resolution, and ... CA during the assembly of both the immature and the mature capsid of HIV-1 and other retroviruses Induced conformational switching in CTD and ⁄ or NTD and ⁄ or alterations in the linker region...
- 12
- 577
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... Astier-Gin et al plus-strand RNA has been determined [10,11] and the involvement of the three stem loops of the 3¢X has been extensively studied both in vitro, in the replicon system and in vivo [7–9,12] ... RNA and that the secondary structures of the stem loops SL-A1, SL-B1, SL-C1 and SL-D1 were unmodified The 5¢-SL-E1 stem loop was unchanged in (–)IRES 239 whereas in (–)IRES 219, the base of the stem ... in the replicon system, NS5B is bound to reticulum membranes and is included in a complex formed by viral and cellular proteins [22–24] We are currently developing a cellular system with a reporter...
- 15
- 597
- 0
Báo cáo hóa học: " Therapeutic immunisation of rabbits with cottontail rabbit papillomavirus (CRPV) virus-like particles (VLP) induces regression of established papillomas" docx
... better understanding of the molecular mechanism that regulate normal cell growth, steps involved in cancerous cell changes [7] and have examined the efficacy of several delivery systems [5,8-10] ... and complete protease inhibitor (Roche), and sonicated The sonicated suspension was centrifuged at 100,000 g at 10°C for 24 h Two distinct bands were observed on the CsCl gradient: the top band ... the adjacent cells and tissues triggered by immune recognition of a primary target, also called a bystander effect [23] Thus the levels of L1 would indeed be detected by the immune system but would...
- 5
- 186
- 0
Báo cáo hóa học: " Molecular and macromolecular alterations of recombinant adenoviral vectors do not resolve changes in hepatic drug metabolism during infection" potx
... distribution patterns and phosphorylation status of PXR and RXRα in vitro and in vivo will further support these hypotheses and are currently underway in our laboratory Materials and methods Figure ... and μl of QuantumRNA™ 18S internal standard (Ambion, Austin, TX) at a primer:competimer ratio of 4:6 for CYP 3A2 and 2C11 and 3:7 for PXR and RXR reactions Gene-specific reaction conditions and ... P450 enzyme isoforms and their therapeutic implications: an update Indian J Med Sci 2007, 61:102-116 Guengerich FP: Cytochrome P450s and other enzymes in drug metabolism and toxicity AAPS J 2006,...
- 17
- 340
- 0
Báo cáo hóa học: " Induction of neutralising antibodies by virus-like particles harbouring surface proteins from highly pathogenic H5N1 and H7N1 influenza viruses" pot
... contributions JS, DK and FLC conceived the study JS and FLC coordinated the research efforts and edited the manuscript BB, PJ, and MM contributed to parts of the experimental work MM, HDK, DK and VV provided ... show increased stability in sera and augmented transduction of primary lymphocytes and CD34+ cells derived from human and non-human primates Blood 2002, 100:823-832 Sandrin V, Cosset FL: Intracellular ... Thailand We made one passage of the original seed virus in MDCK cells and isolated viral RNA using the High Pure RNA isolation kit (Roche Molecular Biochemicals, Mannheim, Germany) HA, NA and...
- 7
- 279
- 0
Báo cáo khoa học: " Serum interferon-gamma and interleukins-6 and -8 during infection with Fasciola gigantica in cattle and buffaloes" ppsx
... hepatica-resistant rats larvae of F hepatica were coated with antibody and host cells, including eosinophils, neutrophils, macrophages and mast cells, before they were destroyed within the peritoneal cavity ... were read against the standard curve taking into consideration the dilution factor Results IFN-γ production No IFN-γ production was observed in infected and control cattle and buffaloes from to ... cattle and buffaloes infected with Fasciola gigantica 137 Fig Serum IL-6 levels in cattle (a) and buffaloes (b) infected with F gigantica Th2 response has been reported in rats, sheep and cattle...
- 5
- 293
- 0
Báo cáo y học: "Altered expression of inflammatory cytokines in primary osteoarthritis by human T lymphotropic virus type I retrovirus infection: a cross-sectional study" pps
... synovial lining cells was assessed in at least five points in an area of more than 1.5 cm × 1.5 cm as follows: -, or cells thick; +/-, or cells thick; ++, 5–9 cells thick; +++, more than 10 cells thick ... immunogenic properties of synovial cells and lymphocytes [6,7] In addition, mice overexpressing Tax, the protein encoded by the HTLV-I pX region, develop RA-like chronic and systemic synovitis [8] Furthermore, ... association of HTLV-I infection and RA in endemic areas in Japan [9,10], although studies in the USA, Europe and South Africa failed to link HTLV-I infection and RA [11-14] These pieces of evidence...
- 8
- 601
- 0
In vitro and in vivo targeted delivery of IL-10 interfering RNA by JC virus-like particles pptx
... contributions MIC and YFH contributed equally to this work MIC and YFH interpreted the data and drafted the manuscript MIC, MW, DC and JTC designed and performed the RNAi and JC virus experiments MZ and GJT ... promoter and shRNA template (HU6-shRNA template) was PCR amplified and packed into VLPs This linear HU6-shRNA template was efficiently packed into VLPs and expressed successfully in cells and animals ... normal mice [17] Many cell types can produce IL-10, including phagocytic cells, conventional DCs, T cells, B cells, and NK cells IL-10 has been implicated as a key anti-inflammatory modulator in...
- 9
- 142
- 0
báo cáo khoa học: "Stability and assembly in vitro of bacteriophage PP7 virus-like particles" pptx
... were chilled on ice and subjected to centrifugation at 13,000 rpm in a microcentrifuge The pellet and supernatant were designated as insoluble and soluble fractions respectively and the amount of ... the 5'- and 3' is shown at ThePP7 bottom, and the sequences2PP7itduplication ends of The sequence at the junction of the 2PP7 duplication is shown at bottom, and the sequences of the 5'- and 3' ... spaced main bands that likely correspond to circular pentamers and hexamers, and two less intense bands representing linear pentamers and hexamers (i.e "nicked" circles) This is in accordance with...
- 10
- 276
- 0
Thermal Stability of RNA Phage Virus-Like Particles Displaying Foreign Peptides potx
... transcription terminator, and the polylinker of pET3d and the kanamycin resistance determinant of and origin of replication of pET9 Note that detailed information about pET3d and pET9, as well as ... mutations in codons 14 and 15 [2] Insertion at Kpn I duplicates Gly14 and Thr15 We call this the 15/14 insertion-mode since amino acids 15 and 14 respectively flank the N- and C-termini of the ... amino acids 13 and 14 (F-13/14), or between residues 13 and 16 with deletion of 14 and 15 (F-13/16) Briefly, we amplified a coat fragment using a primer that attached a Sal I site and the Flag...
- 7
- 231
- 0
Báo cáo y học: "Kinetics and isotype profile of antibody responses in rhesus macaques induced following vaccination with HPV 6, 11, 16 and 18 L1-virus-like particles formulated with or without Merck aluminum adjuvant" ppt
... little cancer, and highrisk types, which cause dysplasia that can progress to cancer HPV type 16 and 18 infection cause 70% of cancer cases and 25% of low grade cervical dysplasia [8] HPV types and ... double-stranded DNA viruses Infection with HPV is the most common viral sexually transmitted diseases worldwide [4] HPV infects cutaneous and mucosal epithelial cells and causes benign and malignant ... million women die from cervical cancer and about half a million are diagnosed with this disease each year [2] Cervical cancer accounts for 12% of all cancers in women and is the second most frequent...
- 11
- 429
- 0
Báo cáo y học: " Human herpes virus 8 replication during disseminated tuberculosis in a man with human immunodeficiency virus: a case report" pdf
... eight patients with HIV and with either KS or KS and MCD, Boivin et al measured HHV-8 DNA levels of up to as high as 47,210/10E5 cells in PBMCs and 256/10 ul (25,600 cells/ ml) in plasma in the ... C, Ramazzotti E, Ensoli F, Andreoni M, Pezzotti P, Rezza G, Yarchoan R, Gallo RC, Ensoli B: Reactivation and persistence of human herpesvirus-8 infection in B cells and monocytes by Th-1 cytokines ... gamma-glutamyltransferase 271 umol/l (normal range: 9-40 U/l) and lactate dehydrogenase 529 U/l (normal range: 125-240 U/l) His CD4+ T-cell count was 224 cells/ mm3 (13%) and his HIV viremia was 2.7E6 copies/ml (Table...
- 5
- 352
- 0
Báo cáo y học: "Lassa virus-like particles displaying all major immunological determinants as a vaccine candidate for Lassa hemorrhagic fever" ppt
... Z3’HIS+GPC+NP, and Z+GPC+NP (lanes 2, 4, 6, 8, and 10, respectively [V]), and μg of total RNA isolated from the corresponding transfected HEK-293T/17 cells (lanes 1, 3, 5, 7, and 9, respectively ... fraction was isolated and frozen at -80°C until analysis IgG and IgM ELISA on recombinant LASV proteins and VLP Murine immunoglobulin-g endpoint titers to whole VLP, and IgG-g to GP1 and GP2 were determined ... Department of Health and Human Services/ National Institutes of Health/National Institute of Allergy and Infectious Diseases Challenge and Partnership Grant Numbers AI067188 and AI082119, and RC-0013-07...
- 19
- 290
- 0
Báo cáo y học: " Self-assembly of virus-like particles of porcine circovirus type 2 capsid protein expressed from Escherichia coli" pptx
... particles and present viral antigens in a more authentic conformation and biological function Therefore, they are easily recognized by the immune system and able to stimulate both B-cell and T-cell ... containing BsaI on both positive and negative strands and a BamHI restriction site were added to the 3′ end of smt3 gene After double digestion with restriction enzymes NcoI and BamHI, the amplified ... BsaI site and the downstream primer (TATCTCGAGTCAAGGGTTAAGTGGGGGGTCTTT) containing the XhoI site The PCR product was purified and then digested with BsaI and XhoI (NEB), cloned into p-SMK, and screened...
- 5
- 454
- 0
Báo cáo khoa học: " The inhibition of assembly of HIV-1 virus-like particles by 3-O-(3'''',3''''-dimethylsuccinyl) betulinic acid (DSB) is counteracted by Vif and requires its Zinc-binding domain" pdf
... HIV-1 VLP production by (A) insect cells and (B) mammalian cells Effects of DSB on HIV-1 VLP production by (A) insect cells and (B) mammalian cells (A), Sf9 cells infected with AcMNPV-Pr55Gag ... indicated on top of panels (a) and (b), and the x-axis of panel (c) Cells were harvested at 48 h pi, and whole cell lysates (WCL) and extracellular VLP analyzed by SDS-PAGE and immunoblotting Blots ... indicated on top of panels (a) and (b), and on the x-axis of panel (c) Cells were harvested at 48 h pi, and whole cell lysates (WCL) and extracellular VLP analyzed by SDS-PAGE and immunoblotting, using...
- 18
- 332
- 0
Báo cáo y học: " Kinetics of hepatitis C virus RNA load during pegylated interferon alpha-2a and ribavirin treatment in naïve genotype 1 patients" potx
... pre-treatment viral production and clearance were high and that in vivo half-lives were a few hours for free HCV virions and 1–70 days for productively infected cells [10] Infected cell death ... to week 2, 4, 8, and 12 of treatment, week point time tend to be better than other time points for predicting SVR, with a PPV of 91% and a NPV of 89% and a very good sensitivity and specificity ... Peginterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose Ann Intern Med 2004, 140(5):346-355 Halfon P, Khiri H, Tran A, Penaranda...
- 5
- 322
- 0
Báo cáo sinh học: "The recombinant adeno-associated virus vector (rAAV2)-mediated apolipoprotein B mRNA-specific hammerhead ribozyme: a self-complementary AAV2 vector improves the gene expression" docx
... follows: HepG2 Cells Detection of ribozyme RB15 RNA in cells by one-step RT-PCR A human hepatoma cell line (HepG2 cells, × 105 cells) was seeded onto each well of a six-well plate until the cells reached ... HepG2 cells The expressed ribozyme RB15 in HepG2 cells HepG2 cells (5 × 105 cells/ well) were infected with rAAV-TTR-RB15 (1 × 1010 particles/well) (A) Total RNA was extracted from infected cells ... single-strand vector mediated a prolonged but not efficient transduction in mouse liver However, the scAAV2 double-strand vector mediated a rapid and efficient gene expression in liver cells This...
- 11
- 222
- 0
Báo cáo sinh học: " Streamlined design of a self-inactivating feline immunodeficiency virus vector for transducing ex vivo dendritic cells and T lymphocytes" ppsx
... theoretically, safe and effective systems for delivering antigenic and/ or adjuvant proteins/ genes to DCs, T cells or both represent valuable means of eliciting and modulating type, extent, and duration ... murine DCs and T cells Methods Parental plasmid and strategy used for packaging and vector construction Prototype vectors and packaging construct were developed from p∆00 (Fig 1A and 2A), a replication-competent ... 293T cells; lane B: no template control; lanes C and D: RNA from transduced 293T cells with and without DNase treatment prior to reverse transcription; lanes E and F: RNA from mock transduced cells...
- 13
- 277
- 0
Báo cáo khoa học: The association of viral proteins with host cell dynein components during virus infection pdf
... dynein light chains DYNLL1, DYNLT1 and DYNLT3, and a strong interaction could be detected between both UL35(VP26) and UL46(VP11 ⁄ 12) and the dynein light chain DYNLT1 and its homolog DYNLT3 [61] In ... neuromuscular junctions, to reach the central nervous system and causes lethal encephalitis in animals and humans After receptor binding, RV enters its host cells through the endosomal pathway via a low-pH-induced ... independent groups used the rabies and Mokola virus phosphoproteins as baits in yeast two-hybrid screens and retrieved DYNLL1 as an interacting partner using PC12 cells and human brain libraries [70,71]...
- 15
- 314
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008