can be received by the solar panels installed on the roof of a house
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt
Ngày tải lên :
23/03/2014, 04:20
... TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3¢; LSYTRF, 5¢-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3¢ The complementary sequences were used as reverse primers Subcloning ... cross the monolayer via the paracellular pathway, thus the accumulation of dye on the basolateral side represents paracellular flux Accumulation of the dye was determined by taking 25 lL aliquots ... from the American Brain Tumor Association ⁄ Michael Reiss Fellowship (A. L.), Art of the Brain (A. L.), unrestricted funds from the Cancer Center of Santa Barbara (A. L.), and National Institutes of...
- 14
- 433
- 0
Báo cáo y học: "The value of monitoring outcomes should be measured by the appropriateness of the respons" ppt
Ngày tải lên :
12/08/2014, 23:23
... a form of continuous assessment of [a risk adjustment] tool calibration as of the clinical process of care Where a change is signaled, either the model fit or the clinical milieu may have changed.’ ... transient and reversible changes in the quality of care.’ Figure shows a simulated series of E-O tracings that could be produced simply by random variation (given the relationships between and ... Real-time monitoring of outcomes is becoming increasingly feasible in health care, and with it the hope of early detection of problems and the ability to tell whether interventions are having their...
- 2
- 199
- 0
Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot
Ngày tải lên :
30/03/2014, 04:20
... NOS and HSP90 by calpain M Averna et al Table Levels of native and 15 kDa calpastatin species in brain and aorta of NMS and HMS rats treated with HSD for weeks The data reported are the arithmetical ... procedure was made quantitative by the use of known amounts of proteins submitted to SDS-PAGE and staining with the appropriate antibody The bands were then scanned, and the areas of the peaks obtained ... M Averna et al In vivo degradation of NOS and HSP90 by calpain higher than in aorta, resulting in a much higher HSP90 to NOS ratio in brain (Fig 1C) A Calpain activation in rat brain and aorta...
- 11
- 344
- 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt
Ngày tải lên :
20/06/2014, 23:20
... Fermentation was carried out at 37°C and 250 rpm, in an anaerobic condition The pH was maintained at 5.5 by the addition of 1.5 M NaOH or 1.5 M H3PO4 (El-Ziney et al 1998) The anaerobic condition was ... filters before analysis 3-HPA standard was synthesized in the lab using resting cells of L reuteri ATCC 55730 as explained below Quantitation of 3-HPA was done by HPLC, as described by Spinler et al ... glycerol to a concentration of ~1.5 × 1010 cells/mL and incubated anaerobically at 37°C for h After the h incubation, the culture was pelleted and the 3-HPA-containing supernatant was collected and filter-sterilized...
- 8
- 399
- 0
standard specification for producing a skid-resistant surface on concrete by the use of a multi-component epoxy s
Ngày tải lên :
24/10/2014, 22:12
... either of these is changed the coating application rate may have to be adjusted A sample should be prepared to evaluate the resulting surface, 2.3.4.2 Aggregate application This rate of aggregate application ... designer may desire to choose a less coarse aggregate gradation The preparation and inspection of a small sample using the proposed aggregate and coating at their proposed rate of application prior ... Coating application This rate of coating application is suitable for the aggregate gradation specified in Article 2.2.2.1 and aggregate rate of application specified in Article 2.3.4.2 If either...
- 6
- 242
- 0
Báo cáo khoa học: The propagation of hamster-adapted scrapie PrPSc can be enhanced by reduced pyridine nucleotide in vitro pdf
Ngày tải lên :
07/03/2014, 03:20
... signals from three independent assays, the relationship between the concentration of NADPH and PrPSc propagation was analysed We found that PrPSc propagation was gradually enhanced with increasing ... maintains a stable propagating capacity in normal brain homogenates after NADPH is removed Because the increased level of NADPH-diaphorase may correlate with the active synthesis of NADPH, one ... propagation was enhanced by the addition of NADPH, which was closely related to increasing NADPH concentrations (Fig 4A, compare lane and lanes 2–9) After densitometric quantification of the PrPSc...
- 10
- 342
- 0
Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process
Ngày tải lên :
08/09/2015, 23:32
... Reliable water inflow data was available only for existing plants in Viet Nam due to the availability of the database supplied by the Load Dispatch Centre of Electricity Vietnam National The data made ... concentrated in the major rice-growing areas of the Chao Phraya basin, northeast Thailand, and the Mekong Delta; (iii) onshore wind potential is concentrated along Viet Nam’s southeast coastline; and ... lignite and coal capacity under the global impacts case and of GW of large hydropower capacity (22 plants), GW of nuclear capacity, and GW of lignite and coal capacity under the regional impacts case...
- 50
- 456
- 0
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE
Ngày tải lên :
04/04/2013, 16:17
... with data and information obtained from the Official Journals of the European Union, Action Aids Vietnam, the Vietnam Leather and Footwear Association, official and unofficial reports, various ... might prevail Any non-market economy country which Albania, is a member of the WTO at the date of the Azerbaijan, initiation of the investigation Le Thanh Hai - A4 - BBE - K41 Armenia, Georgia, Kyrgyzstan, ... prices of all comparable export transactions - A comparison of normal value and export prices on a transaction-to-transaction basis - a weighted average basis may be compared to prices of individual...
- 66
- 538
- 4
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE?
Ngày tải lên :
27/07/2013, 08:50
... non-market economy country Albania, Armenia, which is a member of the WTO at the Azerbaijan, Georgia, date of the initiation of the investigation Kyrgyzstan, Moldova and Mongolia Other non-market ... make comparison: - A comparison of a weighted average normal value with a weighted average of prices of all comparable export transactions - A comparison of normal value and export prices on a ... notice on the Official Journal An investigation shall be carried out within a year, and 15 months is maximum Questionnaire As soon as announcing the initiation of an investigation, the Commission...
- 84
- 544
- 0
Public health functions to be exercised by the NHS Commissioning Board docx
Ngày tải lên :
24/03/2014, 00:20
... agreement”) The 2013-14 agreement is made between the Secretary of State for Health and the National Health Service Commissioning Board (“NHS CB”) under section 7A of the National Health Service Act ... specification may take effect on an agreed date as a variation made in accordance with the 2013-14 agreement This service specification is not intended to replicate, duplicate or supersede any other ... manage the relevant data by April 2013 Due to the mixed economy of systems and local ownership it is accepted that there will be some areas which may fail to meet this aim from April 2013 In these...
- 8
- 483
- 0
Hedge Accounting Comments to be received by 9 March 2011 doc
Ngày tải lên :
29/03/2014, 20:20
... of a forecast transaction subsequently results in the recognition of a non-financial asset or non-financial liability, or a forecast transaction for a non-financial asset or non-financial liability ... of other than accidental offsetting Another example of a lack of a valid expectation of other than accidental offsetting is when the relationship between the changes in the value of the hedging ... than the contractual rate paid on the item The entity can so provided that the benchmark rate is less than the effective interest rate calculated on the assumption that the entity had purchased the...
- 65
- 358
- 0
CAN AESTHETIC THEORIES OF ART BE RESCUED FROM THE PROBLEM OF AVANT-GARDE AND OTHER NON-PERCEPTUAL ARTWORKS? – AN EXPLORATION OF NON-PERCEPTUAL AESTHETIC PROPERTIES pdf
Ngày tải lên :
30/03/2014, 16:20
... appreciation of non-aesthetic art could depend on nothing corresponding to the perception of aesthetic properties in the appreciation of aesthetic art He argues that: “if the appreciation of non-aesthetic ... theories of art focus upon artworks necessarily having aesthetic properties that are relevant to their appreciation as artworks One of the earliest examples of the avant-garde, or non-perceptual art, ... avant-garde artworks in the domain of the aesthetic Since the era of Duchamp’s Fountain, avant-garde artworks have developed to the point of once again challenging the aesthetic theory of art Counterexamples...
- 11
- 505
- 0
Báo cáo y học: "Inhibition of antithrombin by hyaluronic acid may be involved in the pathogenesis of rheumatoid arthritis" potx
Ngày tải lên :
09/08/2014, 06:22
... hylans for the treatment of osteoarthritis: mechanisms of action Arthritis Res Ther 2003, 5:54-67 23 Nagaya H, Yamagata T, Yamagata S, Iyoda K, Ito H, Hasegawa Y, Iwata H: Examination of synovial ... development of RA rather than its initiation, because free HA in the synovium achieves high concentrations along with RA progression Because of abundant Fe3+ and altered Ca2+ metabolism together with ... Thrombin activity of blank was considered as and the activities of other tests were normalized based on comparisons with blank Values are expressed as mean ± standard deviation of data from triplicate...
- 6
- 437
- 0
Báo cáo y học: "Radiographic joint damage in rheumatoid arthritis is associated with differences in cartilage turnover and can be predicted by serum biomarkers: an evaluation from 1 to 4 years after diagnosis" pot
Ngày tải lên :
09/08/2014, 07:20
... sensitive measures that can detect the process of bone and cartilage damage, which may therefore be predictive of radiographically assessed progression of joint damage As a result of cartilage damage, ... during the first years after diagnosis is more a reflection of increased degradation of collagen and enhanced turnover of proteoglycans rather than a lack of synthesis of cartilage collagen This lack ... with the mean C2C value, the total radiographic damage score increases by 29% per year; whereas for patients with C2C one standard deviation above the mean, the average annual increase is as high...
- 9
- 525
- 0
Báo cáo y học: "Granulocyte-CSF induced inflammation-associated cardiac thrombosis in iron loading mouse heart and can be attenuated by statin therapy" pptx
Ngày tải lên :
10/08/2014, 05:21
... thrombosis can only be ameliorated by simvastatin therapy, but not by tirofiban treatment, implying a significant role of inflammation association in our model Simvastatin also ameliorates inflammatory ... Harada M, Qin Y, Takano H, Minamino T, Zou Y, Toko H, Ohtsuka M, Matsuura K, Sano M, Nishi J, Iwanaga K, Akazawa H, Kunieda T, Zhu W, Hasegawa H, Kunisada K, Nagai T, Nakaya H, Yamauchi-Takihara ... M, Misao Y, Lu C, Suzuki K, Goto K, Komada A, Takahashi T, Kosai K, Fujiwara T, Fujiwara H: Acceleration of the healing process and myocardial regeneration may be important as a mechanism of improvement...
- 15
- 342
- 0
Báo cáo y học: "Health status in COPD cannot be measured by the St George’s Respiratory Questionnaire alone: an evaluation of the underlying concepts of this questionnaire" ppt
Ngày tải lên :
12/08/2014, 11:22
... Groesbeek, the Netherlands Authors’ contributions LD participated in the design of the study, the acquisition of the data, performed statistical analyses and interpreted the data, and drafted the ... Department of Pulmonary Rehabilitation for their invaluable contributions to the development of the conceptual models The study was supported by grants of the Dutch Asthma Foundation and GlaxoSmithKline ... physiological functioning and the future Satisfaction Physiological Functioning, Satisfaction Future [7] Satisfaction Relations Satisfaction with the (absent) relationships with spouse and others Satisfaction...
- 7
- 366
- 0
Báo cáo khoa học: "Fertility of frozen-thawed stallion semen cannot be predicted by the currently used laboratory methods" ppt
Ngày tải lên :
12/08/2014, 18:21
... chamber at a temperature of 37.1°C; chambers were prepared from the same sample The chamber was placed on the thermostatically controlled stage of the motility analyzer and video recordings made ... stallion was 37 (min 7, max 121) The mean foaling rate was 60% (min 11%, Page of (page number not for citation purposes) Acta Veterinaria Scandinavica 2006, 48:14 http://www.actavetscand.com/content/48/1/14 ... these variables is clearly not possible Sperm numbers and concentration The total number of sperm/AI dose and concentration correlated negatively with many parameters This can be explained by the...
- 8
- 310
- 0
PERFECT PRESENTATIONS Presenting with impact is a skill that can be learned by anyone
Ngày tải lên :
27/06/2016, 10:30
... Public Speaking • Many dread it • Basic skills can be learned to get message across • With application and good training anyone can be a fluent and confident speaker • A great asset you will use ... present, not the laptop • Is about the message you want to convey Presentation • Like a glass containing good whisky • The glass contain the whisky so that people can appreciate and savour it • Allow ... interest and enthusiasm, • in a way that keeps the attention of your audience Presentation • Always about selling something • An idea • A different way of thinking Presentation tools Presentation tools...
- 23
- 393
- 0
Experimental study on the performance of a prism-shaped integrated collector-storage solar water heater
Ngày tải lên :
05/09/2013, 15:28
... time variation of solar radiation and average temperature of the present experimental study in August and the theoretical results of [1] in June Figure 10 The time variation of solar radiation and ... time variation of the parameter “average temperature /solar radiation” for August from the present study and the published data [1] for June Figure 14 The time variation of the parameter “average ... vertical layer of water along the tank wall Part of this heat is then transferred by diffusion towards the core of the tank The water of the vertical layer becomes lighter than its surrounding and then...
- 12
- 520
- 1
Tài liệu The message of a master - By John McDonald pdf
Ngày tải lên :
15/12/2013, 06:15
... self-evident, as you shall see.’ “Continuing, he said: the great masses of humanity are using the Law destructively, or partially so, and the scales are balanced against them Here and there, among the masses, ... inferior creatures as the beasts of the field, the birds of the air and the fish of the sea are bountifully supplied For any man, no matter what his station in life, to take the stand that it is the ... unconscious of the crowds and with such a peculiar sensation of exaltation and buoyancy that I seemed to be just floating along rather than walking Sleep had no attraction for me and it was with...
- 50
- 861
- 0