calculating the reacting strength of a solution

Báo cáo lâm nghiệp: "Effects of the clear-cutting of a Douglas-fir plantation (Pseudotsuga menziesii F.) on the chemical composition of soil solutions and on the leaching of DOC and ions in drainage waters" pps

Báo cáo lâm nghiệp: "Effects of the clear-cutting of a Douglas-fir plantation (Pseudotsuga menziesii F.) on the chemical composition of soil solutions and on the leaching of DOC and ions in drainage waters" pps

... treatment of data All eld and laboratory measurements and the model-generated data used for budget calculations were administrated by an Access database (Microsoft) using VBA programming Statistical ... directly aected the gravitational ux, which had a short residence The decrease in the mineralization and nitrication rates limited the residual amount of available nitrates after vegetation uptake and ... et al Forest clear-cutting and soil solutions and (ii) the accuracy of the analysis, in which a decit of less than 5% of the ionic charge was measured, can be challenged Anions in the capillary...

Ngày tải lên: 07/08/2014, 16:20

18 416 0
The Marketing Strategy of a multinational join stock company.doc

The Marketing Strategy of a multinational join stock company.doc

... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy of a multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer of the book The Silk Road to International Marketing” had...

Ngày tải lên: 27/10/2012, 16:51

25 624 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...

Ngày tải lên: 24/12/2013, 01:17

6 429 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...

Ngày tải lên: 19/02/2014, 16:20

8 494 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...

Ngày tải lên: 19/02/2014, 19:20

5 585 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...

Ngày tải lên: 21/02/2014, 01:21

12 741 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...

Ngày tải lên: 07/03/2014, 14:20

10 652 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... states, whereas each state in the standard model corresponds is a production state that contains a single observation 2.1 Merging A A (a) A A (b) Figure 1: Example of a HHMM Figure 1 (a) and Figure...

Ngày tải lên: 08/03/2014, 02:21

8 528 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt

... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...

Ngày tải lên: 08/03/2014, 09:20

6 387 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also ... domain, the mechanism of regulating the catalytic activity may be similar to that of the dimer In other word, the active site would be physically blocked and would have to ÔdissociateÕ to achieve...

Ngày tải lên: 08/03/2014, 22:20

9 534 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt

Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt

... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...

Ngày tải lên: 08/03/2014, 22:20

8 551 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf

Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf

... studying the influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are ... Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation of laser parameters influences clearly on the transformation ... reveals that the increase of one mode photon density caused in the decrease of the other one Fig 1a Gain coefficient α1 varies Fig 1b Gain coefficient α2 varies D.V Hoang, M.H Hanh / VNU Journal...

Ngày tải lên: 14/03/2014, 13:20

4 343 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

... S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... neighborhood of U {x(U )}, where x(U ) is the root of U The boundary of each puzzle piece P consists of a rectifiable arc in A( ∞) and a rectifiable arc in J(F ) The latter arc starts at an iterated preimage ... Annals of Mathematics, 159 (2004), 1–52 On the Julia set of a typical quadratic polynomial with a Siegel disk By C L Petersen and S Zakeri To the memory of Michael R Herman (1942–2000) Abstract...

Ngày tải lên: 14/03/2014, 22:20

53 383 0
Đề tài " The diameter of the isomorphism class of a Banach space " pdf

Đề tài " The diameter of the isomorphism class of a Banach space " pdf

... Tzafriri, Classical Banach Spaces I Sequence Spaces, -index of a Banach space, Israel J Springer-Verlag New York (1977) [Mc] R A McGuigan, Jr., Near isometry of Banach spaces and the Banach-Mazur ... lemma follows from Lemma and the the classical fact that every separable Banach space 1-embeds into C[0, 1] Lemma is false for some nonseparable spaces Partington [P] and Talagrand [T] proved that ... dimensional real Banach spaces unless otherwise indicated Y ⊆ X will mean that Y is a closed (infinite dimensional) subspace of X The closed linear span of the set A is denoted [A] We use standard Banach...

Ngày tải lên: 15/03/2014, 09:20

16 376 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of ... represents the first example of the effects of an antimicrobial peptide from frog skin on the proteome of bacteria, and demonstrates that the bacterial membranes are the major targets of its mechanism of...

Ngày tải lên: 16/03/2014, 00:20

18 494 0
Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc

Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc

... FLJ22662 and a putative PLB An attempt was made to purify the 22 ⁄ 42 kDa doublet based on deacylation activity However, the deacylation activity in the acid extracts of granules was low and the activity ... protease contamination of the purified protein preparations was ruled out by the absence of bacterial DNA and the absence of protease activity The former analyses were performed at the routine Department ... molecular masss are indicated in lane Lane 2, material from the acid extracts of granules; lane 3, material from fractions 58–69 of the Sephadex G-75 purification step; lane 4, material from the...

Ngày tải lên: 16/03/2014, 04:20

12 486 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

... primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) For PCR, the reaction mix consisted of · Taq buffer containing 1.5 mm ... of the eyestalk (open bar) and thoracic ganglia (diagonally shaded bars) of females The percentage indicates the GSI of the females M (B) indicates the expression pattern of MIH-B in the same ... purchased from a local seafood market They were acclimated in the laboratory at 25–28 °C in an indoor aquarium for days before rMeMIH-B or dsRNA injection The GSI was calculated as the percentage...

Ngày tải lên: 16/03/2014, 05:20

11 546 0
Báo cáo khoa học: Characterization of the dimerization process of a domain-swapped dimeric variant of human pancreatic ribonuclease pdf

Báo cáo khoa học: Characterization of the dimerization process of a domain-swapped dimeric variant of human pancreatic ribonuclease pdf

... chemical baselines Cpex, expression of the partial heat capacity of the protein relative to the heat capacity of the protein in the native state the monomerization of the dimer), and the latter ... for the putative mechanism of domain-swapping dimerization of RNase A and the human pancreatic ribonuclease variant, PM8 For RNase A (A) , the protein is subjected to conditions that favour the ... the same conditions as the sample and by subtracting the chemical baseline using the method of Takahashi & Sturtevant [33] Enzymatic activity measurements Assessment of the extent of the domain-swapping...

Ngày tải lên: 16/03/2014, 13:20

11 411 0
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

... 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, 5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and 5¢-ggacccgttttgcgTTTtcgaaagtgagc-3¢ Preparation of Ec DosH The (His)6-tagged Ec DosH proteins (wild-type and ... states of Leu mutants of Ec DOS N Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and ... QuikChangeTM mutagenesis kit (Stratagene, La Jolla, CA, USA) with pET2 8a( +)-wild-type Ec DosH as a template and using the following respective 5¢-sense primers: 5¢-gatga gtcgggagACCcagctggagaaaaaag-3¢,...

Ngày tải lên: 16/03/2014, 13:20

14 390 0
w