... Institute, Kolkata On the left (a) is the Main Campus, started in 1917 and located on Acharya Prafulla Chandra Road, near Raja Bazaar in Kolkata On the right (b) is New Building, in the “Acharya ... (Argentina; Australia; Canada; Germany; India; Ireland; Russia; Turkey; United Kingdom and the United States of America) They are (arranged alphabetically): Carlos S Andreo (Argentina); Hermann ... produce the understanding that holds today Names worth recalling from these different lines of inquiry include Heinrich Moser (Austria), Roger Black (Australia) and Tana Bisalputra (Australia and Canada)...
Ngày tải lên: 15/04/2015, 17:20
THE ORIGIN OF ENGLISH
... Lonely and waste is the land they inhabit, Warigeath, wulf –hleothu, windige Wolf –cliffs wild and windy headlands, naessas, Ledges of mist Where and mountain Frence fen –gelid, there forge –steam ... mosquito) PORTUGAL GREECE (marmalade) (theory) FRANCE RUSSIA (boutique) (bistro) ENGLISH HOLLAND ITALY (yacht) (piano) NORWAY GERMANY (ski) (kindergarten) FINLAND (sauna) SWEDEN (ombudsman) ... bones, and threadbare, too • Modern English (1500-now) :the change was the elimination of a vowel sound and the Great Vowel Shift WORDS AND EXPRESSIONS FROM OTHER EUROPEAN LANGUAGES SPAIN ( mosquito)...
Ngày tải lên: 07/07/2013, 01:27
... usually called the Second Law of Thermodynamics This will allow us to understand how living systems are able to sustain themselves against the downward pull of the Second Law of Thermodynamics and ... especially DNA, RNA, and protein, the molecules that are essential for information storage, replication, and metabolism Then we will explore the concept of entropy and its ubiquitous increase in nature, ... that is essential for the emergence of life in a world that so naturally consumes rather than creates information quantifying the information in biopolymers Information theory was developed in...
Ngày tải lên: 01/11/2013, 07:20
Tài liệu Báo cáo khoa học: Quantitative analysis of the experimental O–J–I–P chlorophyll fluorescence induction kinetics Apparent activation energy and origin of each kinetic step Steve Boisvert, David Joly and Robert Carpentier doc
... ms, and 42 ms, respectively In Fig 2, we show FI traces for untreated thylakoids incubated at the maximal and minimal temperaTable Quantitative analysis of uorescence induction (FI) in spinach ... endogenous quinones [13] Visual inspection of the traces in Fig indicates that, for all treatments, the FI rise was faster at 25 C than at 15 C and that the contribution from the OJ phase decreased at ... decrease was compensated for by an increase in the JI phase We also observed that half-times at 15 C were always higher than at 25 C for all steps in all experiments, meaning that all kinetic...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA ... AtxBrcb (R) AtxACFc (F) AtxACrcc (R) AmlFd (F) Amlrcd (R) CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA ... I1, the A and B chains of vaspin and V b berus PLA2, and 121 amino acids for ammodytin I2 The amino-acid sequence of the vaspin A chain was identical in all snake species and was 100% identical...
Ngày tải lên: 17/03/2014, 03:20
The first three minutes a modern view of the origin of the universe s weinberg
... same at B and C Hence they are the same at A and B 34 The First Three Minutes of galaxies in Virgo In fact, of the 33 galaxies in Messier's catalogue, almost half are in one small part of the ... luminosity as was already familiar for a class of stars in our galaxy known as Cepheid variables The reason this was so important was that in the preceding decade the work of Henrietta Swan Leavitt and ... rather a species of them' are really circular discs about the same size and shape as our own galaxy They appear elliptical because most of them are viewed at a slant, and of course they are faint...
Ngày tải lên: 17/03/2014, 13:35
A Philosophical Inquiry Into The Origin Of Our Ideas Of The Sublime And Beautiful
... and acquaintance make the most striking causes affect but little It is thus with the vulgar; and all men are as the vulgar in what they not understand The ideas of eternity and infinity are among ... constraint 31 to themselves, and which is extremely flattering to all Herein it is that painting and many other agreeable arts have laid one of the principal foundations of their power And since, ... that pain arises necessarily from the removal of some pleasure; as they think pleasure does from the ceasing or diminution of some pain For my part, I am rather inclined to imagine, that pain and...
Ngày tải lên: 18/03/2014, 11:11
Báo cáo khoa học: Presence of melanocortin (MC4) receptor in spiny dogfish suggests an ancient vertebrate origin of central melanocortin system pot
... 5¢-CAG CCT CTT GGA AAA TAT TTT GGT CAT TG and 3¢-GAC CAA AAT ATT TTC CAA GAG GCT GAA GAT G The primers were hybridized to opposite strands of the receptor gene and the complete coding sequence was ... may play an important role in the ligand binding [34] while other studies have indicated that this residue may not be participating in the ligand binding [35] for the mammalian receptors It was ... We investigated the mutant receptor both regarding binding of NDP-MSH and a- MSH, and the ability to increase production of adenylate cyclase when stimulated with a- MSH The SacMC4 and the SacMC4 -A5 9E...
Ngày tải lên: 23/03/2014, 20:22
Báo cáo khoa học: "On the Acquisition of Lexical Entries: The Perceptual Origin of Thematic Relations" pptx
... process; in other words, the situation spans the two intervals tt and t2 Finally, an event can be viewed as referring to both an activity and a designated terminating interval; that is, the event spans ... propose a specific algorithm for learning employing a theory of markedness for thematic types and the two strategies of thematic decoupling and constraint relazation and propagation The approach ... verb's meaning will be arrived at after enough training instances are given; for example, from cut as meaning a particular action with a knife, to cut as an action that results in a certain state...
Ngày tải lên: 24/03/2014, 02:20
Understanding Tuberculosis – Analyzing the Origin of Mycobacterium Tuberculosis Pathogenicity Edited by Pere-Joan Cardona potx
... and a small amount of neutrophils A central core contains epithelioid macrophages and a few neutrophils and multinucleated giant cells (Lin et al., 2009) The wall is well organized and contains ... arising from the macrophages and their enzymatic activity Extracellular bacilli also have antifibrotic activity and promote macrophage activation, although they are also thought to inhibit such activation ... organization of the intragranulomatous necrosis The immune response and its magnitude, the bacillary load, the speed of the bacillary growth and the amount of extracellular bacilli, as well as...
Ngày tải lên: 30/03/2014, 23:20
Báo cáo khoa học: Mitochondrial connection to the origin of the eukaryotic cell pdf
... between an archaebacterium and a eubacterium, and the shift in the appearance time of bacterial genes to the present day was merely due to involvement in the analysis of mitochondrial and a- proteobacterial ... found that ValRS sequences of eukaryotes, including amitochondriate T vaginalis and Giardia lamblia, and c-proteobacteria contain a characteristic 37-amino-acid insertion which is absent from the ... however Adducin is a modular protein composed of an N-terminal globular (head) domain, and extended central and C-terminal domains [108] Phylogenetic analysis after a careful search for databases...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo khoa học: Modeled ligand-protein complexes elucidate the origin of substrate specificity and provide insight into catalytic mechanisms of phenylalanine hydroxylase and tyrosine hydroxylase pptx
... domain and the tetramerization domain BH4 is uncharged The aromatic amino acids phenylalanine and tyrosine were implemented in their zwitterionic state with a protonated amine group and a carboxylate ... and ˚ molecules that had at least one atom within a radius of 14 A around the iron atom This sphere included about 50% of the catalytic domain and comprised the entire binding pocket containing ... would allow bidentate, monodentate and other binding modes to be included in further analysis Results Pterin binding to the catalytic domains of PAH and TH Docking of the native cosubstrate BH4 into...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo Y học: Ascidian arrestin (Ci-arr), the origin of the visual and nonvisual arrestins of vertebrate pdf
... mediate its binding to AP2 were identified [23] The presence of the clathrin-binding domain and AP2 binding site in Ci-Arr (Fig 1) suggests that this arrestin also has the ability to internalize the ... splicing in the C-terminus of b-arrestin In the C-terminus, b-arrestins contain a characteristic domain (371–379 for bovine b-arrestin2; arrestin3), which visual arrestins lack [27] This domain is ... clathrin binding (Fig 1) In contrast, vertebrate visual arrestin does not have the ability to bind clathrin and cannot induce receptor internalization [6,8] Ci-Arr retaining this function is apparently...
Ngày tải lên: 31/03/2014, 08:20
hancock - plant evolution and the origin of crop species 2e (cabi, 2004)
... conserved among the Fabaceae lentil and pea (Weeden et al., 1992), mung bean and cowpea (Menacio-Hautea et al., 1993) and the solanaceous potato and tomato (Tanksley et al., 1992) Linkage arrangements ... greatly expanded in the last few years Most efforts have involved rDNA, although several other genes have gained favour, including adh1 and adh2, gapA (glyceraldehyde 3-phosphate dehydrogenase) and ... DNA (dNTPs) and a special heat-stable enzyme, Taq polymerase The DNA strands are separated by heating and then cooled, allowing the primers to hybridize (anneal) to complementary sequences on the...
Ngày tải lên: 03/04/2014, 12:10
the origin of higher clades
... am-m AME ana ang foramens/nerves of Miles’s 1977 original drawing adductor mandibulae A0 , A1 and A1 -OST lateral and mesial sections of adductor mandibulae A1 -OST adductor mandibulae A2 dorsal, ... Oliveira, Henry Evrard and Diego Alarcon Reina Thank you very much, Alejandrita Pelito Lindo, and thanks to our amazing and adorable Tots Pelluda Very special thanks to my parents, Valter and Fatima, ... groove and foramen for orbital artery of Miles, 1977 autopalatine articulatory area for posterior ceratohyal articulatory area for hyomandibula articulatory area for mandible articulatory area for...
Ngày tải lên: 08/04/2014, 00:08
origin of coherent phonons in bi2te3 excited by ultrafast laser pulses
... thinner films still have crystalline structure, as shown in the Raman scattering data in Fig 4(c) The widths of the Raman peaks in the thinner films are slightly wider, indicating longer interatomic ... force, the thermal force, and the polarization force.19 Since our sample has its c axis perpendicular to the sample surface, the ponderomotive force and the thermal force that originate from the ... For the oscillation patterns in Fig 2, a 1g Fast Fourier Transform (FFT) of the data reveals fast and slow oscillations at 3.91 THz and 1.82 THz, corresponding to the frequencies of A2 and A1 ...
Ngày tải lên: 06/05/2014, 08:54
the origin of interferometric effect involving surface plasmon polariton in scattering nearfield scanning optical microscopy
... that the fringes are formed by the interference between SPPs and the in- plane component of the incident wave Fig Numerical simulations of a Gaussian beam radiating on the nanoslit with orientation ... experiment, the laser beam is focused at the tip during sample scanning While in the numerical simulation, the tip is absent and a Gaussian beam with a finite size is focused at the nanoslit center ... [21] The interference pattern observed in [21] was explained as the interference between the illuminating field and the launched SPhP Applying Eq (2), the calculated spacing of the interference...
Ngày tải lên: 06/05/2014, 08:54
origin of coherent phonons in bi2te3 excited by ultrafast laser pulses
... thinner films still have crystalline structure, as shown in the Raman scattering data in Fig 4(c) The widths of the Raman peaks in the thinner films are slightly wider, indicating longer interatomic ... force, the thermal force, and the polarization force.19 Since our sample has its c axis perpendicular to the sample surface, the ponderomotive force and the thermal force that originate from the ... For the oscillation patterns in Fig 2, a 1g Fast Fourier Transform (FFT) of the data reveals fast and slow oscillations at 3.91 THz and 1.82 THz, corresponding to the frequencies of A2 and A1 ...
Ngày tải lên: 06/05/2014, 08:58
the origin of interferometric effect involving surface plasmon polariton in scattering nearfield scanning optical microscopy
... that the fringes are formed by the interference between SPPs and the in- plane component of the incident wave Fig Numerical simulations of a Gaussian beam radiating on the nanoslit with orientation ... experiment, the laser beam is focused at the tip during sample scanning While in the numerical simulation, the tip is absent and a Gaussian beam with a finite size is focused at the nanoslit center ... [21] The interference pattern observed in [21] was explained as the interference between the illuminating field and the launched SPhP Applying Eq (2), the calculated spacing of the interference...
Ngày tải lên: 06/05/2014, 08:58