c with the ndk

... license and will ask you to accept the terms of the license agreements in order to continue with the installation Review the license agreements, choose to accept their terms, and then click the ... you to choose the workspace; you can continue with the default Specifying the Android NDK Location Since this is the first time the workspace will be used for Android NDK development, the location ... project and the test project For the sake of simplicity, uncheck the test project for now, and only keep the main project checked It is always a good practice to not change anything in the Android...

Ngày tải lên: 28/04/2014, 16:44

... using speci c primer sets, namely, Hi_pDEDF (5¢-ACGCGTCGACGTCGGA AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢-CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), ... CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT (P 8C) , and TATGTCTTT (P 9C) , were also synthesized chemically The underlined sequences are changes from the original ... 5¢-GGGGCTTGATCTCAAAATGA-3¢ The caspase-10 gene-speci c primers were: forward, 5¢-GA CGCCTTGATGCTTTCTTC-3¢; reverse, 5¢-ATGAAGGC GTTAACCACAGG-3¢ PCR conditions for these two genes were similar, except...

Ngày tải lên: 07/03/2014, 10:20

... pBS-DC10 a 75-bp insert The pBS-MARCKS 52 nt CU-element plasmid (pBSMARCKS 52 nt) was constructed by annealing the two synthetic oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT ... CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG AAT TCG GGC CCG GGG-3¢) ... with the fulllength 3¢-UTR (C1 , C2 ) were observed with the 52 nt RNA probe To monitor the specificity of protein binding to the CU-rich sequence we transcribed the pBSMARCKS-52 nt construct in the...

Ngày tải lên: 08/03/2014, 08:20

... MS Covalent cross-linking approaches allow: (a) the identification of surface areas involved in protein-protein interactions within protein complexes; (b) the characterization of the distance constraints ... in the presence of ATP No change in the mobility of the Ure2p–Ssa1p complexes was detected in the presence of ATP The stoichiometry of Ure2p and Ssa1p within the 120 and 160 kDa cross-linked complexes ... not located within the client binding pocket of the chaperone Its lack of modification upon complex formation can only be attributed to a conformational rearrangement within Ssa1p that occurs upon...

Ngày tải lên: 15/03/2014, 00:20

... to their speci c recognition site with higher affinity [40], these factors could form a complex even in the presence of several thousand-fold excess of nonspeci c DNA (Fig 1C) The optimum concentration ... establish whether the increase in c- jun mRNA levels could be correlated with the appearance of the factor, rRLjunRP, involved in the formation of complex C2 , observed with rRNE-d, and if the time ... represents EMSA reaction with the loaded fraction and the numbers on top represent the fraction numbers The numbers at the bottom represent the salt concentration in the respective fraction (C) SDS/ PAGE...

Ngày tải lên: 16/03/2014, 18:20

... amplifying the ORF using primers ApaI-Koz-PDE5A1FOR (AAG GGC CCG CCA CCA TGG AGA GGG CCG GCC CCG GCT) and XbaI-PDE5A1REV (GCT TCT AGA CTC AGT TCC GCT TGG TCT GGC TGC TTT CAC), digesting the product and ... was GAG TTC TTT CCT CTC TCA ATC TCC TTG GTC Twelve cycles of Ó FEBS 2003 964 M J Frame et al (Eur J Biochem 270) 95 C for 30 s, 55 C for and 68 C for 16 were used for the PCR reaction (Promega, ... achieved using pcDNA3.1-PDE5 Zeo(–) plasmid with 125 ng of the forward primer, PDE5MUTF (GAC CAA GGA GCT AGA GAG AGG AAA GAA CTC) and the reverse primer, PDE5MUTR (GAG TTC TTT CCT CTC TCT AGC...

Ngày tải lên: 17/03/2014, 09:20

... AAA TAG CTC TGC AGA GCC TGG AGG GGT CGA-3¢) [12] and the IRF-1 consensus sequence oligonucleotide (5¢-GGA AGC GAA AAT GAA ATT GAC T-3¢) were constructed as probes for EMSA The oligonucleotides ... speci c sandwich ELISA, according to the manufacturer’s instructions (Endogen) using matched antibody pairs A 96-well EIA/RIA plate (Corning Inc.), coated with a coating antibody and masked with ... stimulated with the indicated concentrations of IFN -c (A) and IL-12 + IL-18 (mixed at the equal concentrations indicated) and the culture supernatant was assayed to determine the concentrations...

Ngày tải lên: 17/03/2014, 10:20

... interaction may be an artifact caused by the crystallization of lactose-liganded EW29Ch because: (a) in the other EW29Ch molecule of the crystal structure (each crystal contained two molecules ... interacting with the protein, because the resonance signals of the glucose residue overlapping with those of the galactose residue within the lactose affected the subtraction of the free induction ... glucose residue in lactose were not observed However, the crystal structure of EW29Ch with lactose showed that the glucose residue of the lactose molecule interacted with subdomain c of EW29Ch...

Ngày tải lên: 23/03/2014, 04:21

... brucei cytochrome c (pKK223–Tbcytc), its CXXCH variant (pKK223–TbcytcCXXCH), S cerevisiae cytochrome c heme lyase (pACcyc3) and iso-1-cytochrome c (pScyc1) were as previously described [9,33] Cells ... CXXCH wild-type [24,25] Thus, we coexpressed S cerevisiae cytochrome c heme lyase with either T brucei cytochrome c or a CXXCH variant in the cytoplasm of E coli (the cytochromes c from C fasciculata ... Thus, cytochrome-dependent respiration is essential in C fasciculata The structure of C fasciculata mitochondrial cytochrome c The overall structure of oxidized C fasciculata cytochrome c, determined...

Ngày tải lên: 23/03/2014, 04:21

... SC, S cerevisiae; SP, Schizosaccharomyces pombe Only eukaryotic cytosolic enzymes contain positively charged C- terminal extensions The C- terminal sequence of S cerevisiae and Z mays cytosolic ... designed ScSerRSDC20 lacked the 20 C- terminal amino acids, whereas in ScSerRSDC13, only the fragment of 13 amino acids (containing seven lysines) was cut off Truncated yeast SerRS constructs were ... with crude E coli extract containing recombinant Pex21p, which was immobilized on the resin by its N-terminal His-tag Ni2+–nitrilotriacetic acid agarose precharged with Pex21p was incubated with...

Ngày tải lên: 23/03/2014, 09:20

... complex formation between a-2 and the c -2 mutants, the C- terminal part of a-2 (a-2 -C) was synthesized together with c -2 and mutants thereof in E coli The construct of a-2 -C covers the 151 C- terminal ... pET24-VcoadGAB-2 with the oligonucleotide primers VcoadA2-NT_NdeI and VcoadA2-NT_XhoI or VcoadA2CT_NdeI and VcoadA2-CT_XhoI, respectively The accordingly restricted PCR products were ligated with vector ... to c -2 the oadA-2 and oadA-2 -C genes were cloned into the vector pET124b The vector was constructed with the p15A instead of the ColE1 origin of replication [22] and was therefore compatible with...

Ngày tải lên: 23/03/2014, 13:20

... GATCGAATTCTGGCGGGGAACAAGCCG, GATCGAATTCTGCACAAGGTTCTGAACCA, GATCGAATTCTGAGCGACATGAAGGCGGAC, GATCGAATTCTAGCGGACGTGACCCGCCTG, GATCGAATTCCCATCGCAGCCCGCCTTCAGATG, GATCGAATTCTCAGCCGGCTGGCCAGCA, GATCGAATTCCTCACCCCACACCGGCCTAC, ... GATCGAATTCCTCACCCCACACCGGCCTAC, GATCGAATTCCCTACGCTACACCTCCG, GATCGAATTCTGGCCGCCGCAGGC, GATCGTCGACTCATGCAGGCATCTGGCTGTAATTG GATCGTCGACTCAGCTGCGCTCGGACATCTGAAGGC GATCGTCGACTCATATTCGGGACAGCGTGGCTG GATCGTCGACTCACGCCTTCATGTCGCTCAGCAAC ... GATCGAATTCTTTGTCTGTGACCCAGATGC GATCGGATCCTTAGAGGGCATCTGGGTCACAG GATCGGATCCACTCCGCCACTCAGAAACTTAG GATCGAATTCTCACCCACCCATCAGAATC GATCGAATTCCCCCTGCAGATGCCAAAGATG GATCGAATTCGAAGTGCCTAACTGC GATCGAATTCGAGAGACTGGAAGGCAAAG...

Ngày tải lên: 30/03/2014, 09:20

... C. M .C. , Greene, W .C. , Wray, V & Schubert, U (2000) Functional and structural characterization of synthetic HIV-1 Vpr that transduces cells, localizes to the nucleus, and induces G2 cell cycle ... corresponds to the steady state value Structure calculation Calculations were performed with the DISCOVER/NMRCHIsoftware package from MSI with the Amber forcefield using a dielectric constant e ¼ ... such as NCp7, ANT or Tat and nucleic acids ACKNOWLEDGEMENTS We thank C Lenoir and P Petitjean for peptide synthesis, C Vitta for his technical assistance in circular dichroism experiments, C...

Ngày tải lên: 31/03/2014, 23:20

... demonstrates the NDK in a manner that highlights the performance and the re-use cases The NDK contains a compiler and build scripts, allowing you to focus on the C source files and leave the build magic ... from this section The Resources section contains helpful articles and tutorials on the basics of creating Android applications ADT new project wizard Creating the application within the Eclipse IDE ... developerWorks® With the NDK stitched into your build process, you can focus on writing code and not concern yourself so much with the build environment Need to make a change to the application logic? No...

Ngày tải lên: 28/04/2014, 15:30

... C3 C4 C1 C2 C7 C8 C5 C6 C4 C3 C2 C1 C8 C7 C6 C5 C5 C6 C7 C8 C1 C2 C3 C4 C6 C5 C8 C7 C2 C1 C4 C3 C7 C8 C5 C6 C3 C4 C1 C2 C8 C7 C6 C5 C4 C3 C2 C1             By Theorem 1, H is a Bush-type ... electronic journal of combinatorics (2001), #R1 Then for i = 1, , 8, let Ci = ci ct , i and let       H=      C1 C2 C3 C4 C5 C6 C7 C8 C2 C1 C4 C3 C6 C5 C8 C7 C3 C4 C1 C2 C7 C8 C5 ... order 4n Let c1 , c2 , , c4 n be the column vectors of K Let Ci = ci ct , for i = 1, 2, , 4n Then it is easy to see that: i Cit = Ci , for i = 1, 2, , 4n; C1 = J4n , Ci J4n = J4n Ci = 0, for...

Ngày tải lên: 07/08/2014, 06:22

... i k cd c c c c c c c   x d     d ↔ ↔ ↔ ↔ cccccccccc xb c   c c c c c c c d c dxd xc c c c c c c c c xj d     d   d   d   d   d   d   d   c xc c c c c c c c dxl x e c c c c c c c c c   xf d d ... d d     d dc d x   g c c c c c c c c d xh x m d xn     d d     d   x o   d dxp a∼f a∼g b∼f b∼g c e c h d∼e d∼h etc Figure 1: The construction the electronic journal of combinatorics (2002), ... randomness to our construction than the choice of bijections Construction is the version of Construction that produces the graphs in Theorem 1.1 Construction Suppose that q is a prime power such that q...

Ngày tải lên: 07/08/2014, 06:23

... Chicago Philadelphia Philadelphia Chicago Baltimore, Chicago Baltimore Chicago Chicago Baltimore Chicago Chicago Chicago Baltimore Irish, German British Irish Baltimore Baltimore Chicago Chicago ... presenting cells or on infected cells such as hepatocytes CD8 or CD4 T cells can recognize the complex of HLA- class I peptides or class II peptides and act as either effector T cells, helper T cells, ... two alleles with HCV infection were observed in either Caucasians or nonCaucasians in the present study The associations of HLA-class II alleles with HCV infection The protective associations of...

Ngày tải lên: 12/08/2014, 04:21

... Abbreviations ACP1: acid phosphatase locus 1; ACPA: anti-cyclic citrullinated peptide antibodies; ACR: American College of Rheumatology; CAD: coronary atherosclerotic artery disease; CI: confidence intervals; ... error Anti-CCP antibodies, anti-cyclic citrullinated peptide antibodies cerebrovascular accident or peripheral artheriopathy Clinical definitions for CV events and classic CV risk factors were ... 2) In contrast, ACP1*A allele (CG), which was the opposite allelic combination of ACP *C, showed a trend for Table Differences between RA patients with and without CV events according to ACP1 polymorphisms...

Ngày tải lên: 12/08/2014, 17:22

... increased risk for bleeding while receiving APC Because such patients were excluded from the major clinical trials of APC, it may be prudent to withhold therapy with APC from all patients with ... multivariate regression model that included race, sex, and Acute Physiology and Chronic Health Evaluation II score, cirrhosis remained independently associated with the risk of a bleeding event (P ... trials that include these patients, or further postmarketing data, are available Competing interests The authors declare that they have no competing interests References Bernard GR, VIncent JL, Laterre...

Ngày tải lên: 13/08/2014, 08:21

... 2004, 1:38 KAN forward: 5'-ACTGAACCTGACCGTACACGCTCAGGCGCAATCAC-3' KAN reverse: 5'-CCAGCCATTACGCTCGTCAT-3' Standard Curves and Background Detection To determine the relative copy numbers of KAN and ... reverse-transcriptase forward: 5'-ACTGAACCTGACCGTACAGATAAATTACAGGAA GAACCCCCATA-3' FIV reverse-transcriptase reverse: 5'-TGTTAATGGATGTAATTCA TAACCCATC-3' Page 10 of 12 (page number not for citation ... to the N-terminal of the protease and 3' primer MFIVCPL33' (5'-CTGAGATCTGAGCAAGCTTTTACATTACTAATCT AATATTAAATTTAACCATG TTATC-3'), which adds a stop codon and a Hind III restriction site to the C- terminus...

Ngày tải lên: 13/08/2014, 13:20