c with qt for symbian

... License Agreements of Qt Commercial version LGPL version GPL version Licence cost Licence fee charged Free Free Must provide source code changes to Qt No, modifications can be closed Source code ... to set up Carbide .c+ + to use the Qt for Symbian distribution Configuring Qt Support in Carbide .c+ + Open Carbide .c+ +, go to Window → Preferences and select Qt Under the Qt preferences click Add and ... 13 14 14 15 vi Contents 2.2 2.3 2.1.4 Symbian Platform SDK 2.1.5 Open C/ C++ Plug-in 2.1.6 The Carbide .c+ + IDE 2.1.7 Qt for Symbian Using Carbide .c+ + with Qt for Symbian Summary Qt in General Andreas...

Ngày tải lên: 16/02/2014, 00:20

... -D_REENTRANT -DQT_NO_DEBUG -DQT_GUI_LIB -DQT_CORE_LIB -DQT_SHARED -I/usr/share /qt4 /mkspecs/linux-g++ -I -I/usr/include /qt4 /QtCore -I/usr/include /qt4 /QtCore -I/usr/include /qt4 /QtGui -I/usr/include /qt4 /QtGui ... you can compile and run this program using the ubiquitous GNU C compiler, gcc The command to compile a C+ + program is g++, which is a program that calls gcc, treats c and h files as C+ + source ... Alan Ezust received his M.Sc in computer science from McGill University in Montreal He currently works as a Nokia Certified Qt Specialist for ICS (www.ics com), a company that specializes in delivering...

Ngày tải lên: 24/03/2014, 01:21

... except for the code in Chapter 12, which deals specifically with unverifiable code, and code that uses specific constructs such as unsafe uses of static_cast If you’re familiar with C# , safe code ... programmer in the C+ + language with the C+ +/CLI extensions may use classic C+ + code and libraries if needed In fact, you can compile nearly all classic C+ + code with the /clr option The C+ + language ... the C+ +/CLI language extensions is (for all practical purposes) a superset of the classic C+ +, so any C+ + application is automatically a C+ +/CLI application—provided that you compile with the /clr...

Ngày tải lên: 05/10/2013, 07:20

... E coli Ccm apparatus (C) Absorption spectra of concentrated cytoplasmic extracts from E coli coexpressing heme lyase and cytochrome c Wild-type T brucei cytochrome c (black line) and the CXXCH ... Thus, we coexpressed S cerevisiae cytochrome c heme lyase with either T brucei cytochrome c or a CXXCH variant in the cytoplasm of E coli (the cytochromes c from C fasciculata and T brucei have ... cytochrome c by heme lyase was investigated in the cytoplasm of E coli BL21-DE3 cells Plasmids for T brucei cytochrome c (pKK223–Tbcytc), its CXXCH variant (pKK223–TbcytcCXXCH), S cerevisiae cytochrome...

Ngày tải lên: 23/03/2014, 04:21

... as you click the form’s OK and Cancel buttons Click Layout|Lay Out Horizontally Click the background of the form to deselect any selected items, then click Layout|Lay Out Vertically Click Layout|Adjust ... long months no one bought a commercial Qt license In March 1996, the European Space Agency became the second Qt customer, with a purchase of ten commercial licenses With unwavering faith, Eirik ... tertiaryColumnCombo tertiaryOrderCombo Figure 2.16 Naming the form’s widgets Finally, set up the connections: Connect the okButton’s clicked() signal to the form’s accept() slot Connect the cancelButton’s...

Ngày tải lên: 23/03/2014, 22:20

... as you click the form's OK and Cancel buttons Click Form|Lay Out Horizontally Click the background of the form to deselect any selected items, then click Form|Lay Out Vertically Click Form|Adjust ... Metis contract kept Trolltech afloat, while for ten long months no one bought a commercial Qt license In March 1996, the European Space Agency became the second Qt customer, with a purchase of ... 28 } QChar ch = first; while (ch addItem(QString(ch)); secondaryColumnCombo->addItem(QString(ch)); tertiaryColumnCombo->addItem(QString(ch)); ch = ch.unicode()...

Ngày tải lên: 31/03/2014, 10:21

... Kernel Active Objects and Asynchronous Functions What Is a Polymorphic DLL? GUI Architecture High Performance Graphics The Communication Architecture Application Engines, Services and Protocols Symbian ... generic Symbian OS SDK for the developer – all core functionality is included in the particular platform SDK A typical platform contains about 80% common Symbian code and 20% platform-speci c code ... a speci c carrier or to the carrier that the SIM is associated with 1.2.4 CDMA CDMA, which stands for Code Division Multiple Access, is a mobile phone standard that competes with GSM CDMA currently...

Ngày tải lên: 11/08/2014, 21:20

... Slide 5- 24 Functions Calling Functions  A function body may contain a call to another function  The called function declaration must still appear before it is called   Functions cannot be defined ... Pearson Education, Inc Publishing as Pearson Addison-Wesley Slide 5- 16 Call Comparisons Call By Reference vs Value  Call-by-reference  The function call: f(age); Call-by-value  The function call: ... Each task can be implemented with a function  Notice the use of call-by-value and call-by-reference parameters in the following function declarations Copyright © 2007 Pearson Education, Inc...

Ngày tải lên: 12/09/2012, 22:49

... time to practice - Practice in the class - Call some pairs to practice in the class Further practice * Guessing game - Give instruction and check - Listen and answer - Have Ss use the cue cards in ... Thus school ? LN - Call on some pairs to practice in the class - Get feedback - Check up and correct their predictions * Phongs school :- classrooms - 400 students * Thus school :- 20 classrooms ... pairs (closed pairs) - Let them have time to practice - Call on some pairs to practice in the class - Control and give feedback Production (10) Crossword puzzule - Give instruction and check -...

Ngày tải lên: 25/06/2013, 01:27

... viết - Gọi HS đ c nội dung viết - Phân tích độ cao, kho¶ng c ch nÐt nèi gi÷a c c chữ ? T×m c c ch÷ c ®é cao « li ? ? T×m c c ch÷ c ®é cao « li ? ? T×m c c ch÷ c ®é cao « li ? - Cho HS viÕt vµo ... thích hợp - nêu miệng – làm bảng 4 .C ng c - dặn dò : - Cho HS đ c lại bảng trừ phạm vi - Nhận xét chung tiết h c +4 - HS ® c c¸ nh©n GẤP C C ĐOẠN THẲNG C CH ĐỀU I.M C TIÊU: - BiÕt c ch gÊp c c ... t c m c tương đối x c trư c -H c động t c đứng đưa chân sau, hai tay giơ cao thẳng hướng u c u th c m c -Ơn trò chơi “ Chuyền bóng tiếp s c ’’,u c u biết tham gia trò chơi m c bắt đầu c chủ...

Ngày tải lên: 19/10/2013, 04:11

... Directory of Files 135 Iterating foreach Collections: Iterators 141 Accessing a collection: The general problem 141 Letting C# access data foreach container 143 Accessing Collections ... at Dummies.com ® Start with FREE Cheat Sheets Cheat Sheets include • Checklists • Charts • Common Instructions • And Other Good Stuff! To access the Cheat Sheet created specifically for this book, ... Object-Oriented Concept #2: Classification 209 Why Classify? 210 Object-Oriented Concept #3: Usable Interfaces 211 Object-Oriented Concept #4: Access Control 212 How C# ...

Ngày tải lên: 24/01/2014, 18:04

... performance of NET applications The Native Image Generator improves performance by precompiling assemblies into images that contain processor-specific machine code The CLR can then run the precompiled ... settings for the project, and then click OK: a In the Installed Templates list, under Visual C# , click Windows b In the center pane, click Console Application Introducing C# and the NET Framework c ... Code with Ruby and Python Lesson 2: Accessing COM Components from Visual C# Lab: Integrating Visual C# Code with Dynamic Languages and COM Components 15-4 15-19 15-36 viii Programming in C# with...

Ngày tải lên: 24/01/2014, 19:37

... security restrictions In this case, you can add logic to the get accessor to log access or to further restrict access according to business requirements Use Naming Conventions The convention when ... Code with Ruby and Python Lesson 2: Accessing COM Components from Visual C# Lab: Integrating Visual C# Code with Dynamic Languages and COM Components 15-4 15-19 15-36 viii Programming in C# with ... Employee class 10 Uncomment all of the code up to and including the first occurrence of the following code Console.ReadLine(); Notice how the julie object is created by using the constructor, and...

Ngày tải lên: 24/01/2014, 19:43

... ESTS AccountTest.cs CreateSimpleAccount() CreateDefaultAccount() CreateDupAccount() (Internal Only) Account.cs CreateAccount() (Delivered) Figure 3.1: Test Code and Production Code the cold world ... will call CreateAccount with the necessary parameters and verify that CreateAccount works as advertised You can, of course, have many test methods that exercise CreateAccount (not all accounts ... effectively in your project in Chapter This chapter also discusses how to handle existing projects with legacy code We’ll then talk about how testing can influence your application’s design (for...

Ngày tải lên: 16/02/2014, 13:20

... it is zero with the other topics This co-occurrence may just be an accidental fact due to a small training corpus, and the word can indeed occur with other topic types too In these cases it is ... Figure 4: Accuracy results of the first predictions the accuracy, but not as much as we expected: the Support-part of the algorithm effectively remedies prediction inaccuracies Since the same corpus ... minimize cumulative contextualerrors, the best method, with 71.3% accuracy, is the Jumping Context approach which relies on syntactic and semantic information of the input utterance rather than strict...

Ngày tải lên: 20/02/2014, 18:20

... WARRANTIES WITH RESPECT TO THE ACCURACY OR COMPLETENESS OF THE CONTENTS OF THIS WORK AND SPECIFICALLY DISCLAIM ALL WARRANTIES, INCLUDING WITHOUT LIMITATION WARRANTIES OF FITNESS FOR A PARTICULAR PURPOSE ... statistics and to Excel’s statistical capabilities I discuss important statistical concepts and describe useful Excel techniques If it’s a long time since your last course in statistics or if ... functionality, of which statistical capabilities are a subset Into each worksheet cell you can enter a piece of data, instruct Excel to carry out calculations on data that reside in a set of cells,...

Ngày tải lên: 21/02/2014, 10:20

... were compared The Forward primer (FW) TCCGCTGCCAGTCGTCTTCC-3 and Reverse primer (RW) GTCCTCGCGAGTCTAGGCCA – Amplification reaction was performed in 25 l of master cocktail containing 10 mM Tris ... tuberculous subjects Constant amount of mycobacterial DNA was coamplified with known amount of competitor constructs and the absolute absorbance of amplified products (240bp and 198bp) were compared ... and (C) non-tuberculous control [Lanes T and C represent controls amplified for only mycobacterial target and competitor, respectively The amount of competitor used in femtogram (fg) for co-amplification...

Ngày tải lên: 06/03/2014, 04:20