c the big ideas

Introduction to Csharp

Introduction to Csharp

... Preservation of investment C# – The Big Ideas A component oriented language   C# is the first “component oriented” language in the C/ C++ family Component concepts are first class:     Properties, ... header files, code written “in-line” No declaration order dependence C# Program Structure using System; namespace System.Collections { public class Stack { Entry top; public void Push(object data) ... Button { public event EventHandler Click; protected void OnClick(EventArgs e) { if (Click != null) Click(this, e); } } Events Handling Define and register event handler  public class MyForm:...

Ngày tải lên: 23/10/2014, 15:20

41 296 0
Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx

Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx

... pressure over the spinous processes of the cervical spine down to the cervicothoracic boundary, then on both sides of the skull cap along the nuchal line, on the upper medial angle of the scapula (origin ... of the cervical spine, the patient sits on the examination couch with the back of his (or her) knees at the edge of the couch During screening the examining physician stands a short distance in ... detected in anamnesis and screening, there is no compelling reason to carry out further functional diagnostic examinations The fokus (C) system allows the occupational physician to recognize functional,...

Ngày tải lên: 20/06/2014, 00:20

10 575 0
Cú sốc xăng dầu ảnh hưởng đến các thị trường như thế nào.doc

Cú sốc xăng dầu ảnh hưởng đến các thị trường như thế nào.doc

... tăng cao đã tích c c triển khai ca c chính sách tiền tệ thắt chặt Chính sách tiền tệ châu Âu cũng đươ c thắt chặt Do đó theo một nghĩa nào đó, là một sự bùng nổ vào cuối ... biết đươ c ngành sản xuất ôtô gặp họa Những ca c nhà đầu tư lại chuyển vốn của mình vào ca c cổ phiếu của ca c ngành có liên quan đến lượng và ca c ngành kha c không có sự ... lĩnh vư c pin nhiên liệu Thư c tế cả hai chính đảng tại Mỹ đều có thể hiện sự ủng hộ lớn của mình cho ca c lựa chọn nói Điều này đã đươ c nêu ca c sở về chính sách chính...

Ngày tải lên: 01/10/2012, 16:59

7 2,4K 15
Phân tích chiến lược kinh doanh của hệ thống bán lẻ của siêu thị Big C

Phân tích chiến lược kinh doanh của hệ thống bán lẻ của siêu thị Big C

... GIÁ TỔ CHƯ C DOANH NGHIỆP Loại hình c ́u chu c tổ chư c của Big C Giám đ c Big C Thăn g Long Giám Giám đ c đ c Big C Big C The Hải garde Phòn n g Bộ phận sản xuất Giám đ c Big C Đà Nẵng ... bu c với người lao động • C c ràng bu c chiến lư c, kế hoạch … Thị trường cung c p dịch vụ siêu thị Việt Nam c nhiều nhà cung c p quyền l c chi phối thị trường nằm tay nhà cung c p dịch vụ chủ ... Tổng giám đ c hệ thống Big C Việt Nam Giám đ c Big C Huế Bộ phận mua hàng Giám đ c Big C Đồng Nai Giám đ c Big C An L c Bộ Bộ phận phận marke nhân ting Giám đ c Big C Gò Vấp Giám đ c Big C Hoàn g...

Ngày tải lên: 04/04/2013, 11:10

28 1,9K 4
vấn đề thỏa ước lao động tập thể vô hiệu và việc xử lý thỏa ước vô hiệu

vấn đề thỏa ước lao động tập thể vô hiệu và việc xử lý thỏa ước vô hiệu

... định mà ca c bên phải tuân thủ kí kết thỏa ươ c Nếu kí kết thỏa ươ c, ca c bên không thư c hiện theo ca c trình tự này sẽ dẫn đến thỏa ươ c vô hiệu Cụ thể kí kết ca c bên ... tuân theo ca c bươ c sau: - Bươ c 1: Đề xuất yêu c u kí kết thỏa ươ c - Bươ c 2: Đàm phán nội dung thỏa ươ c - Bươ c 3: Tổ ch c lấy ý kiến tập thể lao động nội dung thỏa ươ c - Bươ c 4: ... lợi ích của ca c bên đươ c giải quyết theo ca c nội dung tương ứng quy định pháp luật hiện hành và theo ca c thỏa thuận hợp pháp HĐLĐ cá nhân (nếu có) III KẾT THU C VẤN...

Ngày tải lên: 09/04/2013, 11:32

4 673 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

... principle is strongly influenced by the culture of the corporation to which the firm belongs (the MCC), which encourages participation as a strong value Work teams constitute the system which articulates ... and communication Human resources A key principle for the company’s success, assumed in its culture, is the importance of people and their participation to achieve the proposed strategic objectives ... are co-owners and therefore coparticipants in the company’s decisions and in its results The MCC’s mission was established in the ´ Basic Principles of the Mondragon Co-operative Experience These...

Ngày tải lên: 24/01/2014, 00:20

10 1,1K 1
đánh giá thực trạng của một số tổ chức tài chính vi mô trên thế giới và bài học nâng cao chất lượng hoạt động của tổ chức tài chính vi mô ở việt nam

đánh giá thực trạng của một số tổ chức tài chính vi mô trên thế giới và bài học nâng cao chất lượng hoạt động của tổ chức tài chính vi mô ở việt nam

... c p thi t c tài TCVM (TCVM) nghèo, nâng cao TCVM cho : TCTCVM (TCTCVM NHCSXH) dân (QTDND) TCTCVM TCVM TCTCVM TCVM, TCTCVM TCTCVM v TCTCVM T ng quan tình hình nghiên c u: TCVM : TCVM - - C TCVM ... TCTCVM Vi t Nam K t c u c tài TCVM VÀ C C TCTCVM TCVM NAM TCVM TCVM VÀ C C TCTCVM lý thuy t v TCVM 1.1 Khái ni m TCVM Theo ADB TCVM doanh C n theo World Bank TCVM 1.2 - TCVM m c a TCVM TCVM c ... TCVM 2008) TCVM TCVM ng nghiên c u m c tiêu nghiên c u TCVM TCVM Trong , TCTCVM TCTCVM M, CEP B TCVM Thông q hàng Grameen - mô hình TCVM TCVM TCVM u: TCVM c TCTCVM TCVM Ph m vi nghiên c u TCVM...

Ngày tải lên: 06/02/2014, 20:52

93 871 0
Tài liệu C++ Lab2 Sending the output to a printfile Data Types pptx

Tài liệu C++ Lab2 Sending the output to a printfile Data Types pptx

... CSCI 1380 students Assignment: number Due Date: 1-25-05 Algorithm: Get the radius of the circle Calculate the perimeter using the equation perimeter = * radius * PI Calculate the area using the ... of the circle is: "

Ngày tải lên: 20/02/2014, 08:20

6 400 0
Tài liệu C++ Lab 2 Sending the output to a printfile Data Types: Chapter 2 ppt

Tài liệu C++ Lab 2 Sending the output to a printfile Data Types: Chapter 2 ppt

... of the program as follows, save it to the appropriate subdirectory If you are using the campus computer, save to c: \temp\yourfilename.cpp Replace yourfilename with whatever name you want to call ... main function A program begins executing with the main function Main returns an integer value to DOS { The left bracket indicates the beginning of the main int dollar, quarterR, dimeR, nickelR, ... you want to call it Compile the program and make sure that there no errors Remember to copy the yourfilename.cpp to your floppy disk before logging out of the computer Once you logout all your...

Ngày tải lên: 20/02/2014, 08:20

13 358 0
Tài liệu Hackers & Painters: Big Ideas from the Computer Age pdf

Tài liệu Hackers & Painters: Big Ideas from the Computer Age pdf

... experimental science But the people at either end, the hackers and the mathematicians, are not actually doing science The mathematicians don’t seem bothered by this They happily set to work proving theorems ... sources of ideas are not the other fields that have the word “computer” in their names, but the other fields inhabited by makers Painting has been a much richer source of ideas than the theory of computation ... Someone has to watch over them, and the most efficient way to this is to collect them together in one place Then a few adults can watch all of them If you stop there, what you’re describing is literally...

Ngày tải lên: 20/02/2014, 11:20

274 3,6K 4
Tài liệu Making the Right Moves A Practical Guide to Scientifıc Management for Postdocs and New Faculty doc

Tài liệu Making the Right Moves A Practical Guide to Scientifıc Management for Postdocs and New Faculty doc

... pharmacy, and other allied health professions Because much of the teaching conducted under the auspices of the medical school actually takes place in the hospitals and clinics, these organizations ... place that allow the faculty to appropriately carry out activities, from teaching to research to the provision of clinical care Key academic health center officials include the following: Vice ... researchers before establishing their own laboratories The course in scientific management, which focused on these competencies, received an exceptionally enthusiastic response In the postcourse...

Ngày tải lên: 21/02/2014, 12:20

267 616 0
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc

... importance of this accessory ‘caddie protein’ for copper incorporation into the Streptomyces tyrosinase [7,9] and the expression of active Streptomyces tyrosinase in either Escherichia coli or ... (2006) Crystallographic evidence that the dinuclear copper center of tyrosinase is flexible during catalysis J Biol Chem 281, 8981–8990 Klabunde T, Eicken C, Sacchettini JC & Krebs B (1998) Crystal ... aspects Acta Biochim Pol 53, 429–443 21 Steenbergen JN & Casadevall A (2003) The origin and maintenance of virulence for the human pathogenic fungus Cryptococcus neoformans Microbes Infect 5,...

Ngày tải lên: 06/03/2014, 11:20

13 779 0
Hackers Painters: Big Ideas from the Computer Age potx

Hackers Painters: Big Ideas from the Computer Age potx

... experimental science But the people at either end, the hackers and the mathematicians, are not actually doing science The mathematicians don’t seem bothered by this They happily set to work proving theorems ... sources of ideas are not the other fields that have the word “computer” in their names, but the other fields inhabited by makers Painting has been a much richer source of ideas than the theory of computation ... Someone has to watch over them, and the most efficient way to this is to collect them together in one place Then a few adults can watch all of them If you stop there, what you’re describing is literally...

Ngày tải lên: 06/03/2014, 16:20

274 479 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... evidence for the co-evolution of the C- terminal helix (in particular, an FG motif at the end of the C- terminal helix) with the distinct SRH in the meiotic clade of AAA ATPases Since the conserved ... late-endosome ⁄ vacuole Traf c 2, 622–630 Piper RC, Cooper AA, Yang H & Stevens TH (1995) VPS27 controls vacuolar and endocytic traf c through a prevacuolar compartment in Saccharomyces cerevisiae J Cell...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx

Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspecific alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx

... 5¢-CCT GGC TAC AAG ATA GTG GGC GGT GAA-3¢ and 5¢-TTC ACC GCC CAC TAT CTT GTA GCC AGG-3¢; and V406F, 5¢-CCT GGC TAC AAG TTC GTG GGC GGT G-3¢ and 5¢-CAC CGC CCA CGA ACT TGT AGC CAG G-3¢, respectively ... (V406F) were created using the QuikChange II Site-Directed Mutagenesis kit with the following primers: V406L, 5¢-CCT GGC TAC AAG CTG GTG GGC GGT G-3¢ and 5¢-CAC CGC CCA CCA GCT TGT AGCCAG G-3¢; ... were: TNSALP (V406A), 5¢-TTC ACC GCC CAC TGC CTT GTA GCC AGG-3¢ and a soluble form of TNSALP (V406A), 5¢-GCA GCA AGG CTG CCT GCC TAG TGA TGG TGA TGG TGA TGG CTG GCA GGA GCA CA-3¢ TNSALP (V406L), TNSALP...

Ngày tải lên: 07/03/2014, 05:20

11 500 0
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot

The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot

... Water, My Friend the Chauffeur, The Princess Virginia, etc Copyright, 1907, by The McClure Company Copyright, 1906, by McClure, Phillips & Co vi The Car of Destiny LADY MONICA To Doña María ... THE CAR OF DESTINY BY C N AND A M WILLIAMSON Illustrations by Armand Both iv The Car of Destiny NEW YORK THE McCLURE COMPANY MCMVII OTHER BOOKS BY THE SAME AUTHORS Lady Betty Across the Water, ... school at the convent of the Virgin of Tears with Lady Monica Vale Lady Monica supposed the other day that we were both French, which is a compliment to your accent She said she wished she could...

Ngày tải lên: 07/03/2014, 11:20

424 1,3K 0
Báo cáo khoa học: "a Chat-oriented Dialogue System based on the Vector Space Model" ppt

Báo cáo khoa học: "a Chat-oriented Dialogue System based on the Vector Space Model" ppt

... depending on the absolute value of the associated scores The second score is computed over history vectors The current dialogue history, which is available from the current history repository, includes ... from the collected html files Three basic elements are extracted from the scripts: speakers, utterances and context The speaker and utterance elements contain information about the characters ... reinforce (+), and discourage (–) By using any of these three characters as the first character in the new turn, the user is requesting IRIS to modify the vector space representation of the previous...

Ngày tải lên: 07/03/2014, 18:20

6 499 0
Báo cáo khoa học: "A Preference-first Language Processor Integrating the Unification Grammar and Markov Language Model for Speech Recognition-ApplicationS" potx

Báo cáo khoa học: "A Preference-first Language Processor Integrating the Unification Grammar and Markov Language Model for Speech Recognition-ApplicationS" potx

... selected as the result regardless of the grammatical structure The correct rate of recognition is defined as the averaged percentage of the correct words in the output sentences The correct rate ... with ~hc highest probability among the first k c. o~s~ct¢d ¢rammadcal scnunac~constituents obkaincd during thc course ol'parsi;~ is taken as the result The performance of these various construction ... with the higher probability L~taken as tlc re~uh ~rst- rulG: the rtrst grlunmatlcal ~:ntcnc¢ constilucnt obtained during the c o n ~ of parsing is ulkcn as the Rsuh first-k rule: the sontcnc¢ constltmmt...

Ngày tải lên: 08/03/2014, 07:20

6 393 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt

Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt

... pBS-DC10 a 75-bp insert The pBS-MARCKS 52 nt CU-element plasmid (pBSMARCKS 52 nt) was constructed by annealing the two synthetic oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT ... CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG AAT TCG GGC CCG GGG-3¢) ... 3T3 cells were used for stable transfection with a chimeric luciferase-MARCKS construct and for transient transfection with the cDNAs coding for human HuD and HuR The mouse embryonic carcinoma cell...

Ngày tải lên: 08/03/2014, 08:20

16 754 0
w