... Cancer Activated leukocyte cell adhesion molecule Ferritin Transgelin-2 Cystatin C B-type natriuretic peptide C- reactive protein W1282X mutation Alpha-fetoprotein Cystatin C Pathogen specific ... biomedical sci- Table 1: Potential COPD biomarkers and other diseases in which they have been implicated Potential COPD biomarker Also implicated in References Clara cell protein- 10/16 C- Reactive Protein ... with classical swine fever [191] Vaisocherova et al devised an SPR assay for detection of the candidate pancreatic cancer marker activated cell leukocyte adhesion molecule (ALCAM) that can be...
Ngày tải lên: 12/08/2014, 14:20
... using the CHARMM macromolecular mechanics package [41], c3 3b1 version, and the CHARMM27 parameters and force field [42] The stereochemical quality of the models was evaluated using procheck [29] ... (1993) PROCHECK: a program to check the stereochemical quality of protein structures J Appl Cryst 26, 283–291 Gaboriaud C, Rossi V, Bally I, Arlaud GJ & Fontecilla-Camps JC (2000) Crystal structure ... Schematic representation of the 3D structure of C1 R (PDB code: 1GPZ [27]) and of the modelled structures of HPT1 and HPT2 HPT1 residue Cys15 and HPT2 residues Cys15 and Cys74 are shown in spacefill...
Ngày tải lên: 23/03/2014, 06:20
Tài liệu Defining and Using a Class pdf
... accept that the new keyword creates a new instance of a class (more commonly called an object) IMPORTANT Don't get confused between the terms class and object A class is the definition ... many int variables in a program Each instance of the Circle class is an object that occupies its own space in memory, and runs independently of all the other instances ... object is an instance of that type, created when the program runs For example, it is possible to create many instances of the Circle class in a program by using the new keyword, just as you can create...
Ngày tải lên: 15/12/2013, 00:15
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ... ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC ... GCGGAATTCTTATTTCCCAGCCTGTTGGGCCTG CTTCTGGCTGCCTCACTCC GCGCGATATCGCAAGATGGCGGACATCTCCCTGG CTCAAAGCTTGATTTTGAATTCTGTG CTTCTGGCTGCCTCACTCC GCGCGATATCGCAAGATGGCGGACATCTCCCTGG CTCAAAGCTTGATTTTGAATTCTGTG...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot
... PCR amplification of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L -C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG ... we conjugated CcPCNA to a sensor chip onto which either CcCac1L-N or CcCac1L -C was injected Consistent with results from other organisms [27,33], CcCac1L-N specifically bound to CcPCNA (Fig 3C) , ... 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG To overexpress N-terminal hexahistidine-tagged CcCac1L-N (His-CcCac1L-N) and CcCac1L -C (His-CcCac1L -C) , E coli BL21 cells (DE3) (Novagen) carrying the expression...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
... (5¢-ACGCGTCGACGTCGGA AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢-CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), and Hi_Nterm R (5¢-CGGGATCCCGC TGCTGGTATCGCTCCTTTG-3¢), ... conditions (P8), and AAAGACATA (P9), and their complementary sequences CATGTCTCT (P 2C) , CATGTCCTT (P 3C) , CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT (P 8C) , and ... (forward, 5¢-CCTGATGCAGGCTA CAGTTCT-3¢; and reverse, 5¢-GCATATGCATGTATT TATTTTTCTTC-3¢) and standard procedures The speci c mutation (G to T) was confirmed by sequencing HeLa cells were transfected with...
Ngày tải lên: 07/03/2014, 10:20
Balzani v credi a venturi m molecular devices and machines a journey into the nano world
Ngày tải lên: 13/05/2014, 09:28
Báo cáo khoa học: " Molecular fingerprinting of clinical isolates of Mycobacterium bovis and Mycobacterium tuberculosis from India by restriction fragment length polymorphism (RFLP)" pdf
... prolonged contact with humans [9,10] Further characterization of these clinical isolates using combination of more probes like DR (Direct repeat) and PGRS (Polymorphic GC rich repeat sequence) may ... identical IS1081 RFLP types in M.tuberculosis and M bovis strains, all of which contained copies of IS1081 on the same chromosomal location (Figs & 4) Discussion Infections caused by M tuberculosis ... IS1081 associated restriction fragment length polymorphism in Mycobacterium tuberculosis complex species: a reliable tool for recognizing Mycobacterium bovis BCG J Clin Microbiol 1992, 30, 17721777...
Ngày tải lên: 07/08/2014, 18:20
Báo cáo y học: "Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium" docx
... 5'-GTCCTCTTTGGGCCACCTTCTCCAGAGGG-3'; mCry1 forward 5'-GTGAACGCCGTGCACTGGTTCCGAAAGGGAC-3', mCry1 reverse 5'GTCATGATGGCGTCAATCCACGGGAAGCCTG-3'; mPer2 forward 5'-GATCAGCTGCCTGGACAGTGTCATCAGGTACC-3', ... 5'CTCCTTGGAGGCCATGTAGGCCATGAGGTC-3'; RevErbα forward 5'-CAGCTTCCAGTCCCTGACTCAAGGTTGTCCCACATAC-3', RevErbα reverse 5'-GGCGTAGACCATTCAGCGCTTCATTATGACGCTGAG-3'; Bmal1 forward 5'-CCGTGCTAAGGATGGCTGTTCAGCACATG3', Bmal1 ... 5'-GATCAGCTGCCTGGACAGTGTCATCAGGTACC-3', and mPer2 reverse 5'-CTGAGCGTCGAGGTCCGACTAGGGAACTCAGCC-3' PCR amplification with samples from individual serum shock experiments was carried out at least twice to insure proper replication...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: "Regulation and dysregulation of immunoglobulin E: a molecular and clinical perspective" pdf
... presence of specific growth factors and cytokines, T cell precursors can develop into Th1, Th2, Th17 and Treg cells (Figure 5) Th2 cells, regulated by GATA3 and STAT6 transcription factors, enhance ... via FcεRI encoding IgE CSR leading to IgE production is induced by cytokines IL-4 or IL-13 secreted by T helper (TH2) cells [8] The Role of T cells, Cytokines and Tregs Several T cell derived cytokines ... et al Clinical and Molecular Allergy 2010, 8:3 http://www.clinicalmolecularallergy.com/content/8/1/3 Page of 13 Figure Historical aspects of Immunoglobulin E Charles Richet (A-Credit: Wellcome...
Ngày tải lên: 13/08/2014, 13:22
Design and Implement a SQL Server Database
... thành c ng toàn không làm (all or nothing) Sau ví dụ c điển transaction: Chúng ta muốn chuyển số tiền $500 từ account A sang account B c ng vi c cần làm bư c sau: Trừ $500 từ account A C ng $500 ... $500 vào account B Tuy nhiên vi c chuyển tiền phải th c dạng transaction nghĩa giao dịch xem hoàn tất (commited) hai bư c th c thành c ng Nếu lý ta th c bư c (chẳng hạn vừa xong bư c điện c p hay ... trư c kích thư c database c ch tính toán kích thư c tables, kích thư c ư c đoán mà (xin xem "Estimating the size of a database" SQL Books Online để biết thêm c ch tính) sau thường xuyên dùng số c u...
Ngày tải lên: 25/08/2012, 09:00
Cambridge.University.Press.Analgesia.Anaesthesia.and.Pregnancy.A.Practical.Guide.Jun.2007.pdf
... before conception or confirmation of pregnancy SECTION – PREGNANCY I Procedures in early/mid-pregnancy Cervical suture (cerclage) Ectopic pregnancy Evacuation of retained products of conception ... Fasciculus gracilis Fasciculus cuneatus Posterior spinocerebellar tract Lateral corticospinal tract Anterior spinocerebellar tract Rubrospinal tract Lateral spinothalamic tract Tectospinal tract ... their efficacy in this situation is uncertain and they may cause maternal tachycardia and pulmonary 14 Section – Pregnancy oedema; recent evidence suggests that calcium-channel blockers such as nifedipine...
Ngày tải lên: 21/09/2012, 10:39
Cambridge.University.Press.Learning.Medicine.How.to.Become.and.Remain.a.Good.Doctor.Jan.2008.pdf
... School, referred to “balance of scienti c and clinical excellence, humanitarian and compassionate concern … balance of service and learning, balance of current competence and future adaptability” ... attributes as: • knowledge and understanding • proficiency in basic clinical skills • attitudes necessary for good medical practice and patient care • intellectual curiosity and critical skills • good ... Graduate entry (cont.) Pre-Medical course available UKCAT compulsory UKCAT compulsory Pre-Medical course available UKCAT compulsory UKCAT compulsory Pre-Medical course available UKCAT compulsory Graduate...
Ngày tải lên: 21/09/2012, 10:58
Báo cáo y học: "An unusual case of gout in the wrist: the importance of monitoring medication dosage and interaction. A case report"
... developing chronic tophaceous gout [14] Chronic tophaceous gout occurs after years of recurrent acute gouty attacks and is characterized by persistent pain and swelling in the affected joints Classic ... of uric acid [4] Drugs that may cause hyperuricemia and gout include: diuretics, cyclosporine, low-dose aspirin, ethambuthol, pyrzinamide, and nicotinic acid [4] As some are commonly prescribed ... rule out infection Conclusion This is an uncommon and unusual case of gout in the wrist which occurred in isolation and which may have been induced by a change in anti-hypertensive medication dosage...
Ngày tải lên: 25/10/2012, 10:06
Negative questions in English and Vietnamese - A contrastive analysis
... targets Research background and Methodology 2.1 The subjects The study is conducted at the Hanoi commercial & tourism college (HCTC) where English is a compulsory subject in the curricula During ... for my subject, the mistakes and shortcomings are unavoidable All the constructive criticism and valuable comments are highly appreciated Implication for teaching and learning Teaching and learning ... clausal and subclausal Clausal negation, sometimes called sentence negation, produces a clause which is both syntactically and semantically negative, as in "She isn't happy" In this sentence, negation...
Ngày tải lên: 07/11/2012, 14:36
Self-Assembly and Nanotechnology: A Force Balance Approach
... SELF-ASSEMBLY AND NANOTECHNOLOGY SELF-ASSEMBLY AND NANOTECHNOLOGY A Force Balance Approach Yoon S Lee Scienti c Information Analyst Chemical Abstracts Service A Division of the American Chemical Society Columbus, ... solvation/hydration forces, and hydrophobic force Each section begins with the basic concept of molecular origin followed by intermolecular force and its expansion to colloidal force Colloidal forces basically ... of the colloidal subject and the physical/chemical composition of the surface of the objects, other forces such as steric force, hydrophobic interaction, and solvation force should be included...
Ngày tải lên: 15/11/2012, 10:12
MBA - Stock Market - Stocks And Bonds Profits And Losses A Quick Look At Financial Markets
Ngày tải lên: 07/02/2013, 09:32
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
... influence food choice’ 95 References Cain, W., de Wijk, R., Lulejian, C. , Schiet, F., & See, L. -C (1998) Odor identification: Perceptual and semantic dimensions Chemical Senses, 23, 309–326 Cardello, ... remained constant whereas the consumption of special food (chocolate) declined Our subjects might have considered the snack product to be a staple food since it is yogurt-type product and thus the consumption ... home-use test, subjects received three cups (150 g each) of the snack product at regular aroma concentration and three cups at heightened aroma concentration and were instructed to refrigerate...
Ngày tải lên: 03/04/2013, 21:06
Reducing bureaucracy and encouraging a proactive attitude throughout the workplace
... reach their goal and be more proactive The organization change is a long and hard process and it can be successful only when all the employees understand and execute the change But the perception ... all will come to a conclusion that we should: • Build horizontal structure based on core processes which will facilitate cooperation, and maximize customer and supplier contact • Match the people ... resiliency, emotional intelligence and self-efficacy These POB will make people more energetic, dynamic and ready to cope with difficult and challenging tasks, significantly improve performance especially...
Ngày tải lên: 05/04/2013, 14:58