c programs under unix linux with the gnu tools

... Makefile contains: reciprocal: main.o reciprocal.o g++ $(CFLAGS) -o reciprocal main.o reciprocal.o main.o: main .c reciprocal.hpp gcc $(CFLAGS) -c main .c reciprocal.o: reciprocal.cpp reciprocal.hpp ... make gcc -g g++ -g g++ -g CFLAGS=-g -c main .c -c reciprocal.cpp -o reciprocal main.o reciprocal.o When you compile with -g, the compiler includes extra information in the object files and executables .The ... compilers of choice on Linux systems are all part of the GNU Compiler Collection, usually known as GCC.3 GCC also include compilers for C, C+ +, Java, Objective -C, Fortran, and Chill.This book focuses...

Ngày tải lên: 21/01/2014, 07:20

... exit code of a list is the exit code of the last command in the list Conditional execution Conditional constructs enable a script to decide whether to execute a block of code or to select which ... characters are printed unchanged to the standard output Escape sequences are converted to the characters they represent Format specifiers are replaced with arguments from the command line Escape ... ignores them I often add a character after the hash to indicate the type of comment I can then search the file for the type I want, ignoring other comments The first line is a special type of comment...

Ngày tải lên: 17/02/2014, 17:20

... using speci c primer sets, namely, Hi_pDEDF (5¢-ACGCGTCGACGTCGGA AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢-CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), ... CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT (P 8C) , and TATGTCTTT (P 9C) , were also synthesized chemically The underlined sequences are changes from the original ... 5¢-GGGGCTTGATCTCAAAATGA-3¢ The caspase-10 gene-speci c primers were: forward, 5¢-GA CGCCTTGATGCTTTCTTC-3¢; reverse, 5¢-ATGAAGGC GTTAACCACAGG-3¢ PCR conditions for these two genes were similar, except...

Ngày tải lên: 07/03/2014, 10:20

... pBS-DC10 a 75-bp insert The pBS-MARCKS 52 nt CU-element plasmid (pBSMARCKS 52 nt) was constructed by annealing the two synthetic oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT ... CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG AAT TCG GGC CCG GGG-3¢) ... with the fulllength 3¢-UTR (C1 , C2 ) were observed with the 52 nt RNA probe To monitor the specificity of protein binding to the CU-rich sequence we transcribed the pBSMARCKS-52 nt construct in the...

Ngày tải lên: 08/03/2014, 08:20

... following the incubation under agitation 5120 of the reaction products with 5% formic acid at 37 C for 15 The extracted peptides were vacuum dried, dissolved in 1% formic acid and stored at )20 C until ... in the presence of ATP No change in the mobility of the Ure2p–Ssa1p complexes was detected in the presence of ATP The stoichiometry of Ure2p and Ssa1p within the 120 and 160 kDa cross-linked complexes ... not located within the client binding pocket of the chaperone Its lack of modification upon complex formation can only be attributed to a conformational rearrangement within Ssa1p that occurs upon...

Ngày tải lên: 15/03/2014, 00:20

... to their speci c recognition site with higher affinity [40], these factors could form a complex even in the presence of several thousand-fold excess of nonspeci c DNA (Fig 1C) The optimum concentration ... establish whether the increase in c- jun mRNA levels could be correlated with the appearance of the factor, rRLjunRP, involved in the formation of complex C2 , observed with rRNE-d, and if the time ... represents EMSA reaction with the loaded fraction and the numbers on top represent the fraction numbers The numbers at the bottom represent the salt concentration in the respective fraction (C) SDS/ PAGE...

Ngày tải lên: 16/03/2014, 18:20

... amplifying the ORF using primers ApaI-Koz-PDE5A1FOR (AAG GGC CCG CCA CCA TGG AGA GGG CCG GCC CCG GCT) and XbaI-PDE5A1REV (GCT TCT AGA CTC AGT TCC GCT TGG TCT GGC TGC TTT CAC), digesting the product and ... was GAG TTC TTT CCT CTC TCA ATC TCC TTG GTC Twelve cycles of Ó FEBS 2003 964 M J Frame et al (Eur J Biochem 270) 95 C for 30 s, 55 C for and 68 C for 16 were used for the PCR reaction (Promega, ... achieved using pcDNA3.1-PDE5 Zeo(–) plasmid with 125 ng of the forward primer, PDE5MUTF (GAC CAA GGA GCT AGA GAG AGG AAA GAA CTC) and the reverse primer, PDE5MUTR (GAG TTC TTT CCT CTC TCT AGC...

Ngày tải lên: 17/03/2014, 09:20

... interaction may be an artifact caused by the crystallization of lactose-liganded EW29Ch because: (a) in the other EW29Ch molecule of the crystal structure (each crystal contained two molecules ... interacting with the protein, because the resonance signals of the glucose residue overlapping with those of the galactose residue within the lactose affected the subtraction of the free induction ... increasing concentrations of each sugar For the progressive chemical-shift changes of EW29Ch under conditions of fast exchange on the chemical-shift timescale, 15N and 1HN chemical-shift changes...

Ngày tải lên: 23/03/2014, 04:21

... SC, S cerevisiae; SP, Schizosaccharomyces pombe Only eukaryotic cytosolic enzymes contain positively charged C- terminal extensions The C- terminal sequence of S cerevisiae and Z mays cytosolic ... synthetase and tRNASer under different electrophoretic conditions Croat Chem Acta 77, 599–604 41 Cusack S, Berthet-Colominas C, Hartlein M, Nassar N ¨ & Leberman R (1990) A second class of synthetase ... with crude E coli extract containing recombinant Pex21p, which was immobilized on the resin by its N-terminal His-tag Ni2+–nitrilotriacetic acid agarose precharged with Pex21p was incubated with...

Ngày tải lên: 23/03/2014, 09:20

... complex formation between a-2 and the c -2 mutants, the C- terminal part of a-2 (a-2 -C) was synthesized together with c -2 and mutants thereof in E coli The construct of a-2 -C covers the 151 C- terminal ... pET24-VcoadGAB-2 with the oligonucleotide primers VcoadA2-NT_NdeI and VcoadA2-NT_XhoI or VcoadA2CT_NdeI and VcoadA2-CT_XhoI, respectively The accordingly restricted PCR products were ligated with vector ... to c -2 the oadA-2 and oadA-2 -C genes were cloned into the vector pET124b The vector was constructed with the p15A instead of the ColE1 origin of replication [22] and was therefore compatible with...

Ngày tải lên: 23/03/2014, 13:20

... GATCGAATTCTGGCGGGGAACAAGCCG, GATCGAATTCTGCACAAGGTTCTGAACCA, GATCGAATTCTGAGCGACATGAAGGCGGAC, GATCGAATTCTAGCGGACGTGACCCGCCTG, GATCGAATTCCCATCGCAGCCCGCCTTCAGATG, GATCGAATTCTCAGCCGGCTGGCCAGCA, GATCGAATTCCTCACCCCACACCGGCCTAC, ... GATCGAATTCCTCACCCCACACCGGCCTAC, GATCGAATTCCCTACGCTACACCTCCG, GATCGAATTCTGGCCGCCGCAGGC, GATCGTCGACTCATGCAGGCATCTGGCTGTAATTG GATCGTCGACTCAGCTGCGCTCGGACATCTGAAGGC GATCGTCGACTCATATTCGGGACAGCGTGGCTG GATCGTCGACTCACGCCTTCATGTCGCTCAGCAAC ... GATCGAATTCTTTGTCTGTGACCCAGATGC GATCGGATCCTTAGAGGGCATCTGGGTCACAG GATCGGATCCACTCCGCCACTCAGAAACTTAG GATCGAATTCTCACCCACCCATCAGAATC GATCGAATTCCCCCTGCAGATGCCAAAGATG GATCGAATTCGAAGTGCCTAACTGC GATCGAATTCGAGAGACTGGAAGGCAAAG...

Ngày tải lên: 30/03/2014, 09:20

... C. M .C. , Greene, W .C. , Wray, V & Schubert, U (2000) Functional and structural characterization of synthetic HIV-1 Vpr that transduces cells, localizes to the nucleus, and induces G2 cell cycle ... corresponds to the steady state value Structure calculation Calculations were performed with the DISCOVER/NMRCHIsoftware package from MSI with the Amber forcefield using a dielectric constant e ¼ ... such as NCp7, ANT or Tat and nucleic acids ACKNOWLEDGEMENTS We thank C Lenoir and P Petitjean for peptide synthesis, C Vitta for his technical assistance in circular dichroism experiments, C...

Ngày tải lên: 31/03/2014, 23:20

... license and will ask you to accept the terms of the license agreements in order to continue with the installation Review the license agreements, choose to accept their terms, and then click the ... Eclipse IDE Checking the GNU C Library Version You can check the GNU C Library version by executing ldd version on a Terminal window, as shown in Figure 1-46 Figure 1-46.  Checking the GNU C ... installation directory to keep things safe Check the “Copy projects into workspace” option to ask Eclipse to copy the project code into the workspace, so that you can operate on a copy rather than the original...

Ngày tải lên: 28/04/2014, 16:44

... technical content is crucial too When people modify the software, adding or changing features, if they are conscientious they will change the manual too—so they can provide accurate and clear documentation ... use the continue command after attaching GDB to the process detach When you have finished debugging the attached process, you can use the detach command to release it from GDB control Detaching the ... any code which the child then executes, the child will get a SIGTRAP signal which (unless it catches the signal) will cause it to terminate However, if you want to debug the child process there...

Ngày tải lên: 28/04/2014, 16:49

... the proof of the theorem Theorem 3.1 characterizes the performance of the successive feedback scheme in terms of achievable throughput thereby, obviously, neglecting the impact of recurrent restart ... feedback scheme, the channel description is successively refined within a certain period of time Obviously, the accuracy of the description largely depends on the period length On the other hand, ... gain which in turn again affects the effective downlink capacity though 3.1 FEEDBACK CHANNEL DESIGN General concept For feedback channel design in the frequency-selective case we introduce two fundamental...

Ngày tải lên: 22/06/2014, 19:20

... multiplier λ corresponding to x such that at least one of the four conditions (c1 )– (c4 ) holds We first examine the case where (c1 ) holds, that is x ∈ loc (c, b) Since S (c, b) is finite, loc (c, b) is ... δ > such that loc(D, A, c , b ) ∩ Vx = ∅ for every (c , b ) ∈ Rn × Rn with (c , b ) − (c, b) < δ Since loc (c, b) ⊂ S (c , b ), we conclude that (4) is valid for every (c , b ) satisfying (c , b ... ≤ Therefore μJ = μJ − λJ ≤ q −q bJ − bJ + AJ D−1 (c − c) From this we conclude that there exists δ ∈ (0, δ4 ] such that if (c , b ) satisfies the condition (c , b ) − (c, b) < δ, then the vector...

Ngày tải lên: 06/08/2014, 05:20

... C3 C4 C1 C2 C7 C8 C5 C6 C4 C3 C2 C1 C8 C7 C6 C5 C5 C6 C7 C8 C1 C2 C3 C4 C6 C5 C8 C7 C2 C1 C4 C3 C7 C8 C5 C6 C3 C4 C1 C2 C8 C7 C6 C5 C4 C3 C2 C1             By Theorem 1, H is a Bush-type ... electronic journal of combinatorics (2001), #R1 Then for i = 1, , 8, let Ci = ci ct , i and let       H=      C1 C2 C3 C4 C5 C6 C7 C8 C2 C1 C4 C3 C6 C5 C8 C7 C3 C4 C1 C2 C7 C8 C5 ... order 4n Let c1 , c2 , , c4 n be the column vectors of K Let Ci = ci ct , for i = 1, 2, , 4n Then it is easy to see that: i Cit = Ci , for i = 1, 2, , 4n; C1 = J4n , Ci J4n = J4n Ci = 0, for...

Ngày tải lên: 07/08/2014, 06:22

... i k cd c c c c c c c   x d     d ↔ ↔ ↔ ↔ cccccccccc xb c   c c c c c c c d c dxd xc c c c c c c c c xj d     d   d   d   d   d   d   d   c xc c c c c c c c dxl x e c c c c c c c c c   xf d d ... d d     d dc d x   g c c c c c c c c d xh x m d xn     d d     d   x o   d dxp a∼f a∼g b∼f b∼g c e c h d∼e d∼h etc Figure 1: The construction the electronic journal of combinatorics (2002), ... randomness to our construction than the choice of bijections Construction is the version of Construction that produces the graphs in Theorem 1.1 Construction Suppose that q is a prime power such that q...

Ngày tải lên: 07/08/2014, 06:23

... Chicago Philadelphia Philadelphia Chicago Baltimore, Chicago Baltimore Chicago Chicago Baltimore Chicago Chicago Chicago Baltimore Irish, German British Irish Baltimore Baltimore Chicago Chicago ... presenting cells or on infected cells such as hepatocytes CD8 or CD4 T cells can recognize the complex of HLA- class I peptides or class II peptides and act as either effector T cells, helper T cells, ... two alleles with HCV infection were observed in either Caucasians or nonCaucasians in the present study The associations of HLA-class II alleles with HCV infection The protective associations of...

Ngày tải lên: 12/08/2014, 04:21

... Abbreviations ACP1: acid phosphatase locus 1; ACPA: anti-cyclic citrullinated peptide antibodies; ACR: American College of Rheumatology; CAD: coronary atherosclerotic artery disease; CI: confidence intervals; ... error Anti-CCP antibodies, anti-cyclic citrullinated peptide antibodies cerebrovascular accident or peripheral artheriopathy Clinical definitions for CV events and classic CV risk factors were ... 2) In contrast, ACP1*A allele (CG), which was the opposite allelic combination of ACP *C, showed a trend for Table Differences between RA patients with and without CV events according to ACP1 polymorphisms...

Ngày tải lên: 12/08/2014, 17:22