c listen to the song and put the lines in the correct order
Báo cáo y học: "Mutation in the loop C-terminal to the cyclophilin A binding site of HIV-1 capsid protein disrupts proper virus assembly and infectivity" ppt
Ngày tải lên :
13/08/2014, 09:20
... analysis of capsid mutants A close view of the structure of the cyclophilin A binding loop in the N-terminal (A) and the position of E187 in the C- terminal (B) HIV-1CA domains The two residues in this ... TAA TGC TGA AAA CAT GGG TAT and inner primer pair 5'-CTC TCG ACG CAG GAC TC and 5'-ACC CAT GCA TTT AAA GTT CTA G was used As an internal control, the human β-globin RNA was amplified using the ... unable to detect Tat proteins in Viraffinity concentrated viral lysate using WB analysis with Tat-specific monoclonal antibody Since the E98A mutation is located C- terminal to the CypA-binding site...
- 8
- 266
- 0
Báo cáo khoa học: The organotellurium compound ammonium trichloro(dioxoethylene-o,o¢)tellurate reacts with homocysteine to form homocystine and decreases homocysteine levels in hyperhomocysteinemic mice pptx
Ngày tải lên :
07/03/2014, 09:20
... compound, can react with homocysteine to produce homocystine is important, as the conversion of homocysteine to homocystine and ⁄ or other disulfide mixtures and its renal clearance in the urine ... cysteine molecules, does not appear to mediate the negative activities associated with free homocysteine Hence, increased conversion of homocysteine to homocystine might increase renal clearance and ... washing (30 min) in 50% methanol and 12% acetic acid; two washings (10 each) in 10% ethanol and 5% acetic acid; one washing (10 min) in 3.4 mm K2Cr2O7 and 3.2 mm HNO3; four washings (30 s each) in...
- 12
- 360
- 0
Báo cáo y học: "Curricula for teaching the content of clinical practice guidelines to family medicine and internal medicine residents in the US: a survey study" ppt
Ngày tải lên :
11/08/2014, 05:21
... directors need to consider the value of teaching of the content of CPGs on the clinical care and educational levels (evidence-based medicine user model [32]) The teaching of the content of CPGs can ... adherence to clinical practice guidelines In Evidence Based Clinical Practice newsletter McMaster University; 2008:12 Bachman KH, Mazur DJ: Using practice guidelines to teach residents Acad Med ... of CPGs is suboptimal teaching of CPGs in residency programs The main objective of this study was to determine the characteristics of curricula for teaching the content of CPGs in family medicine...
- 8
- 390
- 0
báo cáo khoa học: " Curricula for teaching the content of clinical practice guidelines to family medicine and internal medicine residents in the US: a survey study" pot
Ngày tải lên :
11/08/2014, 16:20
... directors need to consider the value of teaching of the content of CPGs on the clinical care and educational levels (evidence-based medicine user model [32]) The teaching of the content of CPGs can ... adherence to clinical practice guidelines In Evidence Based Clinical Practice newsletter McMaster University; 2008:12 Bachman KH, Mazur DJ: Using practice guidelines to teach residents Acad Med ... of CPGs is suboptimal teaching of CPGs in residency programs The main objective of this study was to determine the characteristics of curricula for teaching the content of CPGs in family medicine...
- 8
- 342
- 0
Learn how to say things and what you think in english
Ngày tải lên :
20/08/2013, 07:23
... object to another without the objects touching an induction motor Linear (LINES) adjective consisting of or to with lines Motor (DEVICE) noun [C] a device that changes electricity or fuel into ... expressions (and may compare them with the Vietnamese equivalents to see interesting differences), write them down in their language journals and bring them to the class to apply using them in constructive ... Latin American dance music Singers and musicians often dance at the same time as they are singing and playing Ballroom dancing is a type of dancing where a man and a woman dance together using...
- 17
- 725
- 5
Learn how to say things and what you think in English
Ngày tải lên :
23/04/2014, 22:02
... Latin American dance music Singers and musicians often dance at the same time as they are singing and playing Ballroom dancing is a type of dancing where a man and a woman dance together using ... tropical tree from which chocolate and cocoa are made Cocoa noun [U] a dark brown powder made from the crushed beans of the tropical cacao tree, used to make chocolate and give the taste of chocolate ... Icon (COMPUTER SYMBOL) noun [C] a symbol on a computer screen that you point to with a mouse (= movable control device) to give the computer an instruction Desktop (COMPUTER) adjective (of computer...
- 7
- 500
- 0
Leveraging IP to Raise Funding and Improve Your Valuations in a Bear Market_1 pptx
Ngày tải lên :
20/06/2014, 20:20
... Drawings Drawings Designs Designs Leveraging Human Capital Leveraging Human Capital Tools to Direct the Inventive Tools to Direct the Inventive Mind Mind Tools and Services to Tools and Services ... www.ipcapitalgroup.com 14 New Economy Companies are Built on Intellectual Capital Value Creation—Inventory at Source Value Extraction -Convert to capital Human Capital Human Capital Intellectual Assets Intellectual ... proofs, and the team They must “own the right” of their technologies to compete with others who understand this Entrepreneurs must use IP to leverage their business and their plan, and to create the...
- 21
- 371
- 0
Leveraging IP to Raise Funding and Improve Your Valuations in a Bear Market_2 pot
Ngày tải lên :
20/06/2014, 20:20
... highly because of its intellectual property The General Counsel of the startup becomes the General Counsel of the acquiring company and invites ipCapital Group to capture its IP ipCapital Group Insight: ... space enables you to “prove” your business model and technologies “Proving” your business model and technologies attracts Investors “Proving” your business model and technologies attracts Investors ... an ipScan to create an inventory of the startup’s intellectual property and documents the enabled inventions in 27 ipDisclosures Based on the ipDisclosures, the startup’s attorney prepares and...
- 21
- 337
- 0
It hurts to love someone and not be loved in return pdf
Ngày tải lên :
21/06/2014, 11:20
... hạnh ph c 19) The beginning of love is to let those we love be just perfectly themselves, and not twist them with our own image Otherwise; we love only the reflection of ourselves we find in them ... đến theo c ch chúng 21) Happiness lies for those who cry, those who hurt, those who have searched, and those who have tried, for only they can appreciate the importance of people who have touched ... you want to go; be what you want to be, because you have only one life and one chance to all the things you want to 15) C mơ bạn muốn mơ; đến nơi bạn muốn đến; mà bạn muốn là; bạn c đời hội...
- 2
- 436
- 0
Eat That Frog! 21 Great Ways to Stop Procrastinating and Get More Done in Less Time potx
Ngày tải lên :
29/06/2014, 02:20
... Practice the ABCDE Method Continually The first law of success is concentration – to bend all the energies to one point, and to go directly to that point, looking neither to the right or to the ... overcoming procrastination and increasing your productivity Your ability to set your goals, plan and take action on them determines the course of your life The very act of thinking and planning ... important of the so-called “secrets of success.” It is that you can actually develop a "positive addition" to endorphins and to the feeling of enhanced clarity, confidence and competence that they trigger...
- 114
- 584
- 0
Báo cáo khoa học: "Seroprevalence of Antibody to Procine Reproductive and Respiratory Syndrome Virus in Diagnostic Submissions" ppsx
Ngày tải lên :
07/08/2014, 15:20
... herds To avoid introduction of the PRRSV into susceptible swine herds, isolation and acclimatization of incoming boars and gilts for a certain period of time before introducing into breeding herd ... serum[12,13,15] The MARC-145 cells were cultured in 96-well cell culture plates The PRRSV was inoculated at multiplicity of infection of 0.01 onto each cell monolayer The infected plates were incubated ... seroprevalecne of PRRSV antibody in boar, gilt and sow indicates that these pigs in the breeding farms are the major source of PRRSV infection, and also play an important role in spreading the PRRSV...
- 3
- 408
- 0
a biomedical engineering approach to investigating flow and wall shear stress in contracting lymphatics
Ngày tải lên :
13/11/2014, 11:06
... correctly and the correct imaging speeds were chosen, we 29 conducted our in situ experiments 2.7.1 In vitro calibration Calibration experiments were conducted to ensure the accuracy of the camera ... to import these coordinates and calculate the lymphocyte velocity, the distance of the particle from the centerline, and the volume flow rate (Appendix III) 2.7 Results and Discussion Since there ... that the motion artifact inherent to a contracting vessel would introduce to much noise into the system to be able to separate fluid motion from the speckle statistics In addition to this, speckle...
- 196
- 176
- 0
Hydrological consequences of converting forested land to coffee plantations and other agriculture crops in sumber jaya watershed, west lampung, indonesia
Ngày tải lên :
10/09/2015, 15:50
... (2002) focused on soil and land-cover characteristics, which either increase or reduce the infiltration capacity They assumed that infiltration capacity is a crucial factor affecting runoff generation ... because the shape of the hydrograph reflects the way that a catchment transforms precipitation into runoff and embodies the integrated influence of the catchment characteristics, including vegetation ... of the lag-correlation structure The main difference among storm tracking methods is the difference in the choice of the reference point An example of methods for tracking rain movement is including:...
- 299
- 197
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
Ngày tải lên :
07/03/2014, 09:20
... OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG ... gels, which were then heme stained according to Thomas et al [29] The outer membrane cytochromes c OmcA and OmcB, the periplasmic FR, and the cytoplasmic tetraheme cytochrome c CymA were unambiguously ... value matches the sum of both decaheme cytochrome c concentrations in the respective single mutants, again showing that neither decaheme cytochrome c is upregulated in the absence of the FEBS...
- 11
- 731
- 0
Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx
Ngày tải lên :
07/03/2014, 12:20
... promoting binding to the target (e.g [13,16,17]) Binding to the target can increase the Ca2+-binding affinity to CaM further [17,18] In addition, subsequent binding of Ca2+ to the N-lobe then induces ... here called calmodulin-binding domain C2 (BD -C2 , Figs and 3C) The other two regions contain a potential binding site in the N-terminus (BD-N; Figs and 3A) and in the C- terminus (BD -C1 ; Figs and ... structural information on the cytosolic channel domains in complex with CaM Initiated by the finding that hEAG1 channels lacking the entire N-terminal cytosolic domain are insensitive to Ca2+ ⁄ CaM we...
- 13
- 500
- 0
Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt
Ngày tải lên :
15/03/2014, 09:20
... Single-stranded DNA substrate (ssDNA70) was obtained by labeling 100 pmol of HPLC-purified primer WT (5¢-AATTGATCCCGCCCG CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA ACATGGCGCCGCTGCGGGGC-3¢) using 50 lCi ... substrate; C, cleavage product Other bands correspond to nonspeci c cleavage products The products expected from partial reverse splicing of the intron RNA into the insertion site in the DNA are ... stable DNA binding and reverse splicing into doublestranded DNA target sites, although the protein retains its ability to splice RNA and to carry out reverse splicing into single-stranded DNA target...
- 11
- 398
- 0
Linux system programming talking directly to the kernel and c library
Ngày tải lên :
19/03/2014, 13:39
... facilities The C Compiler In Linux, the standard C compiler is provided by the GNU Compiler Collection (gcc) Originally, gcc was GNU’s version of cc, the C Compiler Thus, gcc stood for GNU C Compiler ... handles system call invocation That knowledge is encoded into the standard calling conventions for the architecture, and handled automatically by the compiler and the C library The C Library The ... Contents 241 241 246 248 250 253 Directories The Current Working Directory Creating Directories Removing Directories Reading a Directory’s Contents Links Hard Links Symbolic Links Unlinking Copying...
- 456
- 1.1K
- 1
Báo cáo khoa học: The ubiquitin-like protein monoclonal nonspecific suppressor factor b conjugates to endophilin II and regulates phagocytosis potx
Ngày tải lên :
29/03/2014, 22:21
... USA) The target sequences were as follows: MNSFb siRNA-437, 5¢-CCACCCTGCCATGCTAATAAA-3¢ [3]; and endophilin II siRNA, 5¢-AAGGTGCTCTAGAAACACTAA-3¢ Scramble siRNA directed against 5¢-GGACTCGACGC AATGGCGTCA-3¢ ... phagocytosis in macrophages Dectin-1-mediated intracellular signaling pathways regulating phagocytosis in macrophages remain largely unknown Although Syk involves most of the functions of dectin-1, ... routinely in DMEM with 10% fetal bovine serum and penicillin ⁄ streptomycin at 37 C and 5% CO2 Small interfering RNA duplexes were synthesized and 6362 purified by Qiagen, Inc (Chatsworth, CA,...
- 9
- 359
- 0
– ANSWERS – Set 7 (Page 13) 102. c. A leopard, cougar, and lion all belong to the cat family; doc
Ngày tải lên :
18/06/2014, 17:20
... choice b There are many glaciers in the world today, which rules out choice c 112 – ANSWERS – Set 12 (Page 23) 182.b Coffee goes into a cup and soup goes into a bowl Choices a and c are incorrect ... get together for a drink after work, thereby having an informal gathering Choices a and c describe more formal types of gatherings Choice d describes a chance or coincidental kind of meeting ... meaning of school 191 a Guide and direct are synonyms, and reduce and decrease are synonyms The answer is not choice b or d because neither means the same as reduce Choice c is incorrect because...
- 23
- 431
- 0