C++ Language Tutorial pot
... under which circumstances. With the introduction of control structures we are going to have to introduce a new concept: the compound- statement or block. A block is a group of statements which are ... character into cout. In C+ + a new-line character can be specified as \n (backslash, n): cout << "First sentence.\n "; cout << "Second sentence.\nThird sentence." ; ... a semicolon character (;) at the end, it will also be appended in all occurrences within the body of the program that the preprocessor replaces. Declared constants (const) With the const prefix...
Ngày tải lên: 05/03/2014, 12:20
... and (iii) changing examination policies and ensuring ’quick wins’ for teachers, students and parents. Literacy classes for adults can also reduce parental reluctance and provide legitimacy for local language. Lessons ... texts). Mali, for instance, overcame some teacher resistance by designing the reform to include (i) teacher training in active and effective teaching methods, (ii) a transfer to the second language ... significant because children receiving instruction in first languages are often from more at- risk populations. Socio-cultural benefits. The use of local languages for instruction often leads to inclusion...
Ngày tải lên: 06/03/2014, 10:20
... to form abstract colored candles. COFFEE BEANS Add coffee beans to the base of your molds and coffee essence to the wax for the fragrance. Gently pour in the wax. COLORED BEANS Add colored ... Candle 7. Candle Making Projects - Votive Candles 8. Candle Making Projects - Marble Candles 9. Candle Making Projects - Ice Candles 10. Candle Making Projects - Innovative Candle Ideas ENJOY AND ... DISCOVER. 1. CONTENTS Introduction Equipment You Need for Candle Making Tips to be Aware of for Better Candle Making Candle Making Safety Making Your Own Candles - Two Colored Pillar Candle ...
Ngày tải lên: 11/03/2014, 13:20
Báo cáo hóa học: " Research Article A Domain-Specific Language for Multitask Systems, Applying Discrete Controller Synthesis" pdf
Ngày tải lên: 22/06/2014, 19:20
Tài liệu Matlab tutorial for systems and control theory pdf
... directory, checking the path to the working directory, and changing the working directory. MATLAB checks for MATLAB files in certain directories which are controlled by the command ‘path’. The command ... MathWorks, Inc.) whose URL is http://www.mathworks.com. Full documentation can be purchased by contacting The MathWorks. 2 Getting Started On Project Athena, MATLAB can be accessed directly from ... 5.1 Arithmetic matrix operations The basic arithmetic operations on matrices (and of course scalars which are special cases of matrices) are: + addition - subtraction * multiplication / right...
Ngày tải lên: 12/12/2013, 07:15
Tài liệu Success With Foreign Language - Seven Who Achieved It and What Worked for Them pdf
... English language teaching KRASHEN, Stephen Second language acquisition and second language learning KRASHEN, Stephen Principles and practice in second language acquisition KRASHEN, Stephen Language ... include CANDLIN, Christopher and MURPHY, Dermot Language learning tasks ELLIS, Rod Classroom second language development ELLIS, Rod Classroom language acquisition in context KENNEDY, Chris Language ... practice sentences or texts in a language you are studying. General Editor’s Preface Teachers and learners in second/foreign language teaching and learning have come to welcome Earl Stevick’s...
Ngày tải lên: 16/02/2014, 17:20
Tài liệu Báo cáo khoa học: "Discriminative Syntactic Language Modeling for Speech Recognition" pdf
... Linguistics, pages 225–231. Ciprian Chelba and Frederick Jelinek. 2000. Structured language modeling. Computer Speech and Language, 14(4):283–332. Ciprian Chelba. 2000. Exploiting Syntactic Structure ... Exploiting syntac- tic structure for language modeling. In Proceedings of the 36th Annual Meeting of the Association for Computational Linguistics and 17th International Conference on Computa- tional ... describes experiments using the approach. 2 Background 2.1 Previous Work Techniques for exploiting stochastic context -free grammars for language modeling have been ex- plored for more than a decade....
Ngày tải lên: 20/02/2014, 15:20
PERIPHERAL BLOOD BASED C-PCR ASSAY FOR DIAGNOSING EXTRA-PULMONARY TUBERCULOSIS pdf
... sequence of the primers used to amplify the 240bp region was: Forward primer (FW) 5- TCCGCTGCCAGTCGTCTTCC-3 and Reverse primer (RW) 5- GTCCTCGCGAGTCTAGGCCA – 3. Amplification reaction ... quantification of mycobacterial Fig. 6—Representative agarose gel electrophoresis picture(s) of C- PCR amplified products for the calculation of mycobacterial load from peripheral blood specimens ... used specimen for revealing the presence of tubercle bacilli in TB. However, its clinical significance in EPTB is very discouraging 3 . The diagnosis in such cases posses great challenge...
Ngày tải lên: 06/03/2014, 04:20
Báo cáo khoa học: Selective modulation of protein C affinity for EPCR and phospholipids by Gla domain mutation pdf
... the concentration of sEPCR, an anti-EPCR monoclonal antibody (RCR-2) was covalen- tly immobilized on a carboxymethylated dextran (CM5) sensor chip (BIAcore) using amine coupling chemistry, according ... procedures). A nonreactive mAb was used as a control for nonspeci c binding in the reference flow cell. Increasing concentrations of wild-type sEPCR (13–106 n M) were injected across both flow cells. ... bind anionic phospholipid surfaces [16,26,27] and is there- fore crucial for its activity. The crystal structures of recombinant sEPCR, and sEPCR in complex with the Gla domain of protein C, have recently...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: "A Flexible Approach to Natural Language Generation for Disabled Children" pdf
... natural human language by the machine. It can be conceptualized as a process leading from a high level communicative goal to a sequence of communicative acts that accom- plish this communicative ... of a sentence (like sub- ject, object, verb etc.) but do not have the compe- tence to construct a grammatically correct sen- tence by properly arranging words. The intended audience offers both ... “Compan- sion” project (McCoy, 1997), a novel approach was taken to enhance the communication rate. The system takes telegraphic message as input and automatically produces grammatically cor- rect...
Ngày tải lên: 17/03/2014, 04:20
Báo cáo khoa học: "Towards an Optimal Lexicalization in a Natural-Sounding Portable Natural Language Generator for Dialog Systems" pdf
... MR, the lexical choice process (number 2 in figure 1) constructs a set of all potential output candidates. Section 2.5 describes the lexical choice process in detail. Lexical search (number ... semi-automatically labeled with frames and semantic roles. For each frame, all the occurrences in the corpus are ordered according to their frequency for each separate va- lence pattern. This ... syntactically correct sentences convey the meaning in a concise yet clear manner. Secondly we can define the portability requirement to include both domain and language independence. Domain-independence...
Ngày tải lên: 17/03/2014, 06:20
Interferon-c Release Assays for Active Pulmonary Tuberculosis Diagnosis in Adults in Low- and Middle-Income Countries: Systematic Review and Meta-analysis pdf
... with suspected active pulmonary tuberculosis or patients with confirmed cases in low- and middle-income countries. We summarized test performance characteristics with use of forest plots, hierarchical ... of relevant criteria from the Quality Assessment of Diagnostic Accuracy Studies (QUADAS) tool, a validated tool for diagnostic accuracy studies [23]. Because of growing concerns about con- flicts of ... 15:188–200. 13. Denkinger CM, Dheda K, Pai M. Guidelines on interferon -c release assays for tuberculosis infection: concordance, discordance or confu- sion? Clin Microbiol Infect 2011; 6:806–14. 14....
Ngày tải lên: 22/03/2014, 18:20
The Harvard Classics Volume 38, by Various Copyright laws are changing all over the world. Be sure to check the copyright laws for your country before downloading or redistributing this pdf
... that struck him said he heard that he had cheated at dice, and he had drawn a large sum of money from him, and was accustomed to cheat. They called me to dress him; which I did, as it were for the ... from the seduction of females or males, of freemen and slaves. Whatever, in connection with my professional practice, or not in connection with it, I see or hear, in the life of men, which ought ... this, that in the cities there is no punishment connected with the practice of medicine (and with it alone) except disgrace, and that does not hurt those who are familiar with it. Such persons are...
Ngày tải lên: 22/03/2014, 23:20
Báo cáo khoa học: "Efficient Multi-pass Decoding for Synchronous Context Free Grammars" pdf
... search heuristic as they do for speech recognition. Second, we explore heuristics for agenda-based search, and present a heuristic for our second pass that combines precomputed language model infor- mation ... advanced decoding algorithm will use the constrained space (a lattice in the case of speech recognition) as a grammatical constraint to help it focus on a smaller search space on which more discriminative ... Enoch Peserico. 2005. Some com- putational complexity results for synchronous context- free grammars. In Proceedings of Human Lan- guage Technology Conference and Conference on Empirical Methods...
Ngày tải lên: 23/03/2014, 17:20