c language binding in the odmg standard
A STUDY ON THE USE OF CLASSROOM DISCIPLINE AS MOTIVATION FOR SECOND LANGUAGE ACQUISITION IN THE CONTEXT OF ENGLISH LANGUAGE TEAC
... factors affecting Second Language Acquisition can be classified into three categories: contextual factors, social factors and linguistic factors Contextual factors, according to Walqui.A, include ... findings on the characteristics of Second Language Acquisition, as follows: The characteristics of Second Language Acquisition include: • second language acquisition is highly systematic • second ... second language acquisition in the classroom, therefore only the main theoretical aspects of linguistics shall be under discussion in the study The study seeks to deal with problems occurring in...
- 41
- 886
- 12
Tài liệu New and improved Products in the FIBRO Standard Parts Catalogue 2008 docx
... 19 Casting/tooling resins: thinning agent H9 Centering pin for lifting flange C 15/4 Centring inserts D 213 Centring pins to Daimler standard D 215 Centring pins to VW standard D 214 Centring ... 115 C C C C A 44, C A 44, C C A 44 2140.01.01 2140.01.02 2140.02 2140.10 2140.11 2140.13 2140.14 2140.15 2140.16 C 48 C 49 C 39 C 34 C 35 C 33 C 33 C 32 C 34 C 12 C 10 C C 10 C 11 C 11 C 12 C ... gantries These systems are being used successfully in many industries worldwide Applications include linking machine tools (automotive production), tool changing in machining facilities, palletising...
- 18
- 1,179
- 0
Tài liệu Báo cáo khoa học: Cobalamin uptake and reactivation occurs through specific protein interactions in the methionine synthase–methionine synthase reductase complex docx
... of MS During primary turnover, the homocysteine -binding domain (dotted barrel) and the CH3-H4-folate binding- domain (black barrel) form discrete complexes with the cobalamin -binding domain (dark ... quenching of flavin fluorescence, confirming that these two proteins not interact with hMS We have compared the electrostatic potentials for the surface of the CPR FMN domain (in the region of the ... results in a quenching of the intrinsic flavin fluorescence, suggesting that the flavin chromophore is shielded from the solvent in the protein–protein complex [19] From the fluorescence titration assays,...
- 10
- 698
- 0
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc
... structure of IC in the complex with CPY is represented as a surface model (A) The binding interface between IC and CPY The IC residues at the buried surface in the complex with CPY constitute the ... the CPY -binding sites [8] and the phospholipid recognition site of IC overlap, and that the N-terminal segment at the CPY -binding sites participates in regulation of the speci c binding of IC ... family Consequently, the binding characteristics of PEBP proteins, including those of the binding of IC to phospholipid membranes, are currently unclear and remain to be clarified The present in vitro...
- 10
- 645
- 1
Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc
... restriction maps of the E focardii c- T1 and c- T2 nanochromosomes Coding, noncoding regions, introns, and telomeres (C4 A4 ⁄ G4T4) are indicated in the key The coding sequences of the E focardii c- T1 ... GATA-transcription factor binding site in the c- T2 promoter, although other processes might also be involved In multicellular organisms, GATA -binding factors play critical roles in development, including ... centrosome function in the closed orthomitosis of the micronucleus We did not detect c- tubulin or microtubules in the macronucleus of E focardii, in contrast to reports that c- tubulin and microtubules...
- 16
- 467
- 0
Báo cáo khoa học: "The use of formal language models in the typology of the morphology of Amerindian languages" potx
... Argentina Evan L Antworth 1990 PC-KIMMO: a two-level processor for morphological analysis.No 16 in Occasional publications in academic computing No 16 in Occasional publications in academic computing ... agglutinative language In this language the verb is the morphologically more complex wordclass The grammatical category of person is prefixed to the verbal theme There are suffixes to indicate plurals ... Active affected(Medium voice, Med): codifies the presence of an active participant affected by the action that the verb codifies The toba has a great quantity of morphological processes that involve...
- 6
- 439
- 0
Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx
... nonreducing end of the acceptor chain at the cytoplasmic face [20] In some cases a single enzyme catalyses the formation of more linkages and this, of course, poses difficulties for the maintenance ... Fuc3NAc is linked to both the reducing end as well as to the nonreducing end of the Rha-backbone of the oligosaccharide, i.e the structure is Fuc3NAc–Rha–Rha–(Fuc3NAc)–RhaOH Figure 8B shows the ... reflected in the chemical shifts of C1 of Fuc3NAc, which is downfield in comparison to the other fragments A change in the / and w angles has been shown to give rise to a difference in the chemical...
- 9
- 454
- 0
Báo cáo khoa học: "Language ID in the Context of Harvesting Language Data off the Web" ppt
... all the pairs, a post-processing procedure would check all the pairs for an IGT and link the IGT to the language code with which the pair has the highest confidence score Using the same kinds ... deterministic dependencies In Proc of AAAI-06 Hoifung Poon and Pedro Domingos 2007 Joint inference in information extraction In Proceedings of the Twenty-Second National Conference on Artificial Intelligence ... citation matching In Proc of the 20th Conference on Uncertainty in AI (UAI 2004) Fei Xia and William Lewis 2007 Multilingual structural projection across interlinear text In Proc of the Conference on...
- 9
- 397
- 0
Báo cáo y học: "No evidence for an association between the -871 T/C promoter polymorphism in the B-cell-activating factor gene and primary Sjögren''''s syndrome" pptx
... 5'-GCTGTGCTACGTCGCCCT-3' and 5'-AAGGTAGTTTCGTGGATGCC-3' for β-actin Primers were designed to be specific for full-length BAFF, excluding any amplification of ∆BAFF Each sample was run with initial ... PCR using the following primers: 5'-TGAAACACCAACTATACAAAAAG-3' and 5'-TCAATTCATCCCCAAAGACAT-3' for Page of (page number not for citation purposes) Genotypic and allelic frequencies were compared ... downregulation of their expression in patients with increased BAFF levels might further amplify the increase in BAFF protein levels More speculatively, a decrease in ∆BAFF protein, which inhibits secretion...
- 5
- 401
- 0
Curcumin modulates dopaminergic receptor, CREB and phospholipase c gene expression in the cerebral cortex and cerebellum of streptozotocin induced diabetic rats potx
... determined using Scatchard analysis [32] The specific binding was deter- Page of 11 mined by subtracting non-specific binding from the total The binding parameters, maximal binding (Bmax) and ... the internal control β-actin in the same samples (ΔCT = CTTarget - CT β-actin) It was further normalized with the control (ΔΔCT = ΔCT - CTControl) The fold change in expression was then obtained ... abnormalities, including reduced locomotor activity [43] The present experiments further revealed the effect of curcumin to modulate the dopaminergic receptors in the cerebellum by standardising the altered...
- 11
- 413
- 0
ELUCIDATING THE ROLE OF REDOX EFFECTS AND THE KU80 C-TERMINAL REGION IN THE REGULATION OF THE HUMAN DNA REPAIR PROTEIN KU
... Sequence (5'→3') Sense ATACCGTCCCACCATCGGGC Antisense GAATTCCTAAGCAGTCACTTGATCCTTTT 30A CCCCTATCCTTTCCGCGTCCTTACTTCCCC 3 0C GGGGAAGTAAGGACGCGGAAAGGATAGGGG 12 Following incubation, virus inoculum ... manifested by the introduced C- terminal truncation in the protein’s primary structure Redox Effects on DNA Binding – To assess the effect of redox on Ku binding we used the cysteine specific oxidant, ... activate the side chain of a specific amino acid that then forms an intermediate This intermediate then acts as a nucleophile and attacks the side chain of an adjacent amino acid forming a covalent...
- 76
- 440
- 0
The current situation of English language teaching in the light of CLT to the second-year students at Thai Nguyen College of Economics and Finance - a case study
... Communicative Language Teaching (CLT) Communicative Language Teaching Theories 1.1.2 Communicative Language Teaching Theories 1.1.3 Characteristics of CLT 1.1.4 Conclusion 1.2 Communicative language ... difficulties in the 2.3.1.8 28 implementation of CLT in their context of language teaching 2.3.1.9 The degree of success in applying CLT at TCEF 29 2.3.2 Results of the class observation 30 2.3.3 Interview ... subjects about CLT 21 2.3.1.6 CLT ’s application in the actual classroom practice 24 2.3.1.7 Evaluation of English textbook regarding in CLT 27 application Teachers’ opinions about the difficulties...
- 7
- 1,020
- 5
The triumph of tagalog and the dominance of the discourse on english language politics in the philippines during the american colonial period 3
... should be maintained as the language of instruction In the first place, the introduction of the dialects as the language of instruction would be a divisive influence Wherever the question of the possible ... Philippines, in molding the colonial discourse of Philippine culture and civilization, and in initiating the discourse to explain English in the Philippines To a certain extent, Worcester recalls ... as the language of commerce: “It is the language of business and diplomacy,”204 the “trade -language of the Orient,”205 “rapidly becoming the common language of commerce, science and diplomacy,”206...
- 36
- 516
- 0
The triumph of tagalog and the dominance of the discourse on english language politics in the philippines during the american colonial period 4
... Philippine culture) is impossible within the English language policy Anglo-American culture is inscribed within English as Philippine culture is inscribed within the local languages When it suited them, ... education in the vernacular The supposed weakness of the local languages, which led Barrows to predict their demise in 1908, was an erroneous prediction; the local languages were in fact gaining ... reflection of the very secure place of colonial officials finally felt they had achieved for English The confidence in the central and permanent place of English in Philippine society and the...
- 23
- 483
- 0
The triumph of tagalog and the dominance of the discourse on english language politics in the philippines during the american colonial period 5
... American colonial officials to conceive of engaging local linguists who were articulating their ideas in the semisavage language their calls for making the semisavage language the medium of communication ... the choice of the medium of instruction because “there were no books in any one of them [the local languages],” the Bureau of Insular Affairs concluded that had Filipinos succeeded in learning to ... American acts of suppression and in underscoring their acceptance by the occupied people “Official history,” Renato Constantino tells us, “influenced by colonial scholarship, has presented the...
- 27
- 530
- 0
The triumph of tagalog and the dominance of the discourse on english language politics in the philippines during the american colonial period 6
... was; and the second was on the point of which language was better suited as the language of instruction American colonial officials insisted on the backwardness of the local languages and their ... we find an almost instinctive sense of the idea of knowledge being inscribed into language It is interesting to note how these essays combine the objective of moving forward with the essence of ... among the members of the Katipunan, the concept of loob and finding the right path for the inner self was inscribed into the understanding of freedom Andres Bonifiacio had called on the Filipino...
- 45
- 889
- 0
The triumph of tagalog and the dominance of the discourse on english language politics in the philippines during the american colonial period 7
... and their professors They belonged to the Jackson Club (Democratic), the opponent of the Lincoln Club (Republican), because the Democratic Party was for Philippine independence but the Republican ... saw as the principal predicament of Philippine culture They included in their book several other essays that were, according to them, “against the uncompromising Anglo-Saxon culture.” These essays ... Bernardo on the other represent the two principal (but as yet separate) concerns in language Lopez’s goal in advocating the use of the vernaculars as the medium of instruction was the achievement...
- 39
- 508
- 0
The triumph of tagalog and the dominance of the discourse on english language politics in the philippines during the american colonial period 8
... and the Tydings-McDuffie bill, political independence was achieved As the crusade was focused on the political and economic (continued economic dependencies, not economic independence), there ... dependencies Constantino calls this sector of society the “economic and political elite” and describes them as “coterminous or at least intimately interrelated” and as “becoming increasingly reluctant ... privileged class Benedict Anderson’s “Cacique Democracy in the Philippines,” Michael Cullinane’s Ilustrado Politics, and Julian Go’s American Empire and the Politics of Meaning all track the character...
- 29
- 387
- 0
The triumph of tagalog and the dominance of the discourse on english language politics in the philippines during the american colonial period 1
... exposing actual American interests, inadvertently underscores the idea of blind acquiescence Without contesting the veracity of Constantino’s discourse and without denying the importance of continually ... projected their presence in the Philippines and in particular their presence in and policies on Philippine public education This chapter contains a comparison between American education policies ... function within the discourse created about language by the Americans (common language, democracy, efficiency) but also function through concepts outside of this realm As such, their function in...
- 36
- 775
- 0
The triumph of tagalog and the dominance of the discourse on english language politics in the philippines during the american colonial period 2
... Education in the Netherlands East Indies and the Philippines.” Winstedt’s has a curt and rather humorous description of the language of instruction in the Philippines: The curriculum on the theoretical ... within the colonial structure with their foils, their successors, as examples of the more typical colonial officials concerned only with the efficient running of the colonial machinery The technique ... introducing the soldier side by side to the teacher indicates a policy that sees education as, in the least, a force to maintain order Colonial officials at the turn of the century, be they the...
- 20
- 373
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25