c kit expression identifies cardiac precursor cells in neonatal mice

... GFP–PrPC fusion protein in Xenopus intermediate pituitary cells In the Xenopus intermediate pituitary, melanotrope cells produce vast amounts of POMC Confocal microscopy using an anti-POMC IgG recognizing ... neuroendocrine secretory cells In these cells, the prohormone proopiomelanocortin (POMC) is processed to a number of bioactive peptides, including a-melanophore-stimulating hormone (a-MSH) Once released ... CACAAAGTAAACAAAGAGAGT-3¢, respectively) resulting in a 599-bp PCR product Inserting the EcoRI · XbaIdigested PCR fragment behind the GFP sequence in the pPOMC-GFP vector (containing a 529-bp Xenopus POMC gene A promoter...

Ngày tải lên: 16/03/2014, 14:20

... containing NotI) ATA AGA ATG CGG CCG CCC AGT TGT TCA ACT CAC CCT TCA and ([R] containing AgeI) TGT ACC GGT GGG TTG GAG AAA TCT CTG ACA GCT The MLC-2 construct was created by replacing the backbone ... described rat MLC-2 promoter[20] ([F] containing NotI) ATA AGA ATG CGG CCG CGA CCC AGA GCA CAG AGC ATC GT ([R] containing AgeI) TGT ACC GGT GAA TTC AAG GAG CCT GCT The cTnC construct was created ... primer containing NotI) ATA AGA ATG CGG CCG CAC CCA TGC CTC CTC AGG TA, (reverse [R] Des enhancer primer containing XhoI) CCG CTC GAG GGT GGG GCC TCA AGT TTA T, ([F] Des promoter primer containing...

Ngày tải lên: 14/08/2014, 19:22

... age Others included in Group II include CCL2, CCL3, CXCL1, CXCL9 and CXCL10, which are all chemokines implicated in inflammatory pathology in response to PVM infection These age-dependent differential ... infected mice vs RNA from lung tissue from agematched uninfected controls; t = day after inoculation Ages of mice at time of inoculation are as indicated; acorresponding immunoreactive protein ... http://www.virologyj.com/content/7/1/320 incidence of cardiac arrhythmias [25] RSV infection also correlates with an increased incidence of central apnea, without any specific association to the ensuing inflammatory response...

Ngày tải lên: 12/08/2014, 02:20

... UDPGlcNAc Once inside microsomes, the latter can, in turn, be exchanged with cytosolic UDP-glucuronate thanks to a UDP-glucuronate–UDPGlcNAc antiport Stimulation of UDP-glucuronidase by UDPGlcNAc ... also be involved in the formation of glucuronate Interestingly, vitamin C formation is induced in Gunn rats by phenobarbital [8], an inducer of UGT2s, which is indirect evidence for the involvement ... result of a glucuronidation– deglucuronidation cycle, with a hypothetical acceptor present in the microsomal fraction Against this is the finding that saccharo-1,4-lactone did not affect the formation...

Ngày tải lên: 19/02/2014, 07:20

... effects of vitamin E succinate on the expression of c- jun gene and protein in human gastric cancer SGC-7901 cells World J Gastroenterol 8, 782–786 Chinenov, Y & Kerppola, T.K (2001) Close encounters ... green, coupled with its sensitivity to minor groove binding drugs, actinomycin D and distamycin A, confirms that these are minor groove binding proteins rRLjunRP is an  40 kDa protein that interacts ... regenerating liver indicated that the factor rRLjunRP induced by partial hepatectomy interacts with complex C1 , resulting in the formation of complex C2 If rRLjunRP is interacting with RLjunRP complexed...

Ngày tải lên: 16/03/2014, 18:20

... Slc27a1 UCP2 GTCGGTGTGAACGGATTTG GGAAAGTGAAGAGCATCATAACC GCAAAGAAGGGAAACCTGTG CCTGGATTAGGACCAAAGGA TGCAGAGGTTCTCTGGACAGT CCACTCAGCAGGGAACATCA GAAAGGGACCTCTCCCAATG CTTGCCGTGGGTAGAGTCAT ATGACACATTCCACCACCAG ... GAAAGGGACCTCTCCCAATG CTTGCCGTGGGTAGAGTCAT ATGACACATTCCACCACCAG TCCAGTTATGGGTTCCACATC ATTTTGCTGGACTGGTCAGA GTGGGGATCACCTTTTCCTT GGCATATTTCACCGATGTACTGC GGAGGTCGTCTGTCATGAGG 859–1008 289–412 1071–1207 981–1126 ... Cystatin C Cathepsin L Cathepsin S Cytoskeletal Sarcosin Fast myosin alkali light chain (MYL1) Talin Actinin alpha associated LIM protein Arg ⁄ Abl-interacting protein (ArgBP2) Myosin light chain...

Ngày tải lên: 23/03/2014, 13:20

... that activation of the thyrocyte thyrotropin/cAMP pathway induces characteristic morphological changes, associated with complete disruption of actin-containing stress fibers Cells display a cubical ... for specificity Coimmunoprecipitation COS cells were cotransfected using Superfect (Invitrogen) with the complete HA-tagged p76RBE in pcDNA3 and with expression vectors containing various myc epitope-tagged ... p76 RBE in transfected COS cells RBE in mammalian COS cells and We expressed EGFP-p76 36 h after transfection obtained a light diffuse cytoplasmic staining with a clear perinuclear accumulation...

Ngày tải lên: 23/03/2014, 21:20

... reduction in protein synthesis, in comparison with cells infected in the absence of the inductor, or in those cells inducibly expressing the T7 RNA polymerase (VT7) Expression of HCV results in ... of cellular and viral protein synthesis in cells expressing HCV polyprotein Time-course analysis of cellular and viral protein synthesis in cells expressing HCV polyprotein A: BSC40 cells infected ... significantly decreased in RL-/infected cells (Figure 9C) , while in PKR-/- cells, such levels remained similar to those in PKR+/+ cells (Figure 9B) These findings indicate that expression of HCV...

Ngày tải lên: 19/06/2014, 08:20

... reduction in protein synthesis, in comparison with cells infected in the absence of the inductor, or in those cells inducibly expressing the T7 RNA polymerase (VT7) Expression of HCV results in ... of cellular and viral protein synthesis in cells expressing HCV polyprotein Time-course analysis of cellular and viral protein synthesis in cells expressing HCV polyprotein A: BSC40 cells infected ... significantly decreased in RL-/infected cells (Figure 9C) , while in PKR-/- cells, such levels remained similar to those in PKR+/+ cells (Figure 9B) These findings indicate that expression of HCV...

Ngày tải lên: 20/06/2014, 04:20

... dnuorgkcab c/ blaB derbtuo na si un/un -c/ blaB ]91,4[ hcraeser recnac-itna ni enil llec recnac desu yltnelaverp tsom eht fo eno dna enil llec irolyp retcabocileH amonicraconeda cinoloc namuh citatsatem-non ... ,C allepaC ,E aicloS 42 7468-1468 ,01 ,4002 seR recnaC nilC ecnatsiseromehc elbicudni detaidem-Bappak rotcaf raelcun gnitegrat niciburoxod htiw noitanibmocomehc levon a smrof dna ecim edun cimyhta ... )esuom/llec 01 × 1( sllec 502OLOC fo noitatnalpmi retfa syad 12 ta tcart IG fo strap morf detcelloc erew selpmas ,yduts tneserp eht nI niats revlis yb ,enil llec amonicraconeda cinoloc namuh citatsatem-non...

Ngày tải lên: 07/08/2014, 18:21

... 0.01 compared with sham Decrease of intestinal endocrine cells after CT 26-implantation in Balb /c mice 11 at 4 C in a humidity chamber After rinsing in PBS, the sections were incubated in secondary ... Results In this study, four types of IR endocrine cells were detected in the intestines of Balb /c mice; against serotonin, gastrin, hPP, and CCK-8 Serotonin- and CCK-8-IR cells were identified in ... strain-specific characteristic of Balb /c mice [10] In conclusion, endocrine cells are the anatomical units responsible for the production of GI hormones Any change in the density of these cells...

Ngày tải lên: 07/08/2014, 20:23

... these changes Genes of interest encoded cytokines and chemokines (IL-8, granulocyte-macrophage colony-stimulating factor, IL-3 receptor) and signaling molecules (JNK1, Jun B, PKC-β) An implication ... [18] In some studies, confirmation of the microarray findings has been accomplished using independent methods such as realtime PCR [14,19] or detection of the encoded proteins [20] Of interest in ... included heat shock protein-70, and others encoding proteins involved in cell cycling A second report generated using MS patients is the only one that has examined longitudinal specimens from patients...

Ngày tải lên: 09/08/2014, 01:23

... with acute or chronic AIA) were thawed and cultured in DMEM containing 20% FCS in a concentration of × 100 cells/ well in 24-well dishes After days, the FLS cells were incubated with 0.25% trypsin ... FLS cells from chronically inflamed knee joints on NK1 receptor expression Unlike the presence of FLS cells from chronically inflamed joints, the supernatant of FLS cells from chronically inflamed ... above) in a concentration of 105/ml The two cell types were co-cultured for 24 hours in DMEM containing 100 ng/ml NGF maintained at 37 C in a humidified incubator gassed with 5% CO2 in air As a control,...

Ngày tải lên: 09/08/2014, 10:20

... GCTTCACATAGCGCTGCA Sense TGACTGCTCGGAGTTCTCCC Antisense GTCAGCACCAGAGCCTGGAG Sense GCGGCTCGAGGAAGAGAAGA Antisense AGGCTCTGATATGCCCCATC Sense ACAGTCAGCCGCATC Antisense AGGTGCGGCTCCCTA Sense ATGAGCACTGAAAGCATGATC ... ATGAGCACTGAAAGCATGATC Antisense GGCGATGCGGCTGATGGT Sense CGGCCGAAGAGTTCACAAGT Antisense AGTGCAGTCCTGTGGCTTC Sense TAAATCTTTTCTGCTTACTGA Antisense TACTCAATTTATTCTAATTTGAAT TLR2 TLR4 GAPDH TNF-α CD14 MD-2 ... HO-1 knockout mice and observed in a patient with HO-1 deficiency [22,23] In RA, HO-1-expressing cells were located in the lining and sublining layers, but not in the cartilage-pannus junction,...

Ngày tải lên: 09/08/2014, 10:22

... a selective dopamine D1 receptor antagonist, significantly reduced spontaneous locomotor activity in diabetic mice, but not in non diabetic mice [46] In our study, curcumin and insulin increased ... destruction of insulin secreting pancreatic β -cells by STZ [25] Previous reports showed that curcumin has the potential to protect pancreatic islet cells against STZ-induced death and dysfunction ... significantly decreased (p < 0.001) in diabetic condition In cerebral cortex curcumin and insulin treatment reversed the altered expression in diabetes to near control In cerebellum curcumin treatment...

Ngày tải lên: 10/08/2014, 05:21

... malignancies Abbreviations NSCLC: non-small cell lung carcinoma; LCNEC: large cell neuroendocrine carcinoma; LCC: large cell carcinoma; SCLC: small cell lung carcinoma; CSC: cancer stem cell; LC: ... 10 LCC M 66 T1N0M0 IA *Ref [31] eosin according to the WHO classification LCNEC has its characteristic cancer cells with relatively larger cytoplasm, less fine chromatin and more distinct nucleoli ... pathological classification To explore protein markers to distinguish LCNEC from SCLC, we investigated cancer cells prepared by laser microdissection from FFPE sections of LCNEC, SCLC, and LCC with...

Ngày tải lên: 10/08/2014, 09:22

... CCCAACCAGGCGCAGAT 3' 5' AGGGATCCAGATGCCCTTGTA 3' 5' 6FAM-CGCCAGATCCAAGCACCTTCACCTT-TAMRA 3' 5' CCGCGACTACAGCCACTACTACAC 3' 5' GAGCCTGTTCCGTCTCAAA 3' 5' FAM-CGTGGTGCCACCATTGAGAACTCCAGGACCACG-BHQ1 ... Thermalcycler with the following cycling condition: cycle at 48 C for 45 minutes, cycle at 94 C for minute, cycles of 94 C for 15 seconds, 63 C for 30 seconds followed by 40 cycles of 94 C for second, ... the study of CTC in circulation is an active area of research, many challenges remain to accurately characterize these cells Firstly, tumor cells in circulation are infrequent, ranging from 1/105...

Ngày tải lên: 10/08/2014, 22:20

... C- E2-BC-r 5-AAACTCGAGTCAGAAAGCACTACCG BC unit C- E2-AD-f C- E2-AD-r 5-AAGGATCCATGCGGCTAGCCTGCAAG 5-TAGCTCGAGTCAATCTTCATTTTCCAC BC + AD units BC + AD units C- E2-f 5-TTTGGATCCGCCACCATGGTATTAA GGGGA CAGATCG ... vaccine C- strain widely used for prophylactic vaccination in China and two subgroup 2.1 strains recently circulating in China (strains QZ-07 and HZ1-08) CSFV vaccine C- strain was obtained from ... CAGATCG 5-ATTCTCGAGTCAACCAGCGGCGA GTTGTTCTG 2442-2465 C- E2-r 2804-2816 Vaccine C- strain 2442-2456 2955-2969 Full-size E2 2379-2397 Full-size E2 3541-3560 QZ-E2-AD-f 5-AAAGGATCCCGCCTGTCCTGTAAGG BC...

Ngày tải lên: 11/08/2014, 21:21

... hepatitis C virus coinfection Ann Clin Microbiol Antimicrob 2005, 4:13 31 Sagnelli E, Coppola N, Marrocco C, Onofrio M, Sagnelli C, Coviello G, Scolastico C, Filippini P: Hepatitis C virus superinfection ... indicates that the presence of circulating HBV-DNA does not necessarily influence HCV replication (Figure 1B) Conflicting data were reported concerning the dominant role of either HBV or HCV in co-infected ... replication by hepatitis C virus core protein in HuH-7 cells J Virol 1993, 67:5823-5832 Sagnelli E, Coppola N, Scolastico C, Filippini P, Santantonio T, Stroffolini T, Piccinino F: Virologic and clinical...

Ngày tải lên: 12/08/2014, 01:21

... (forward primer, 5’-CTGCCTGGCAGAAAACTTACC-3’; reverse primer, 5’-CTCTGTTATTCTCTGGTGAGTCT CCTT-3’; probe, 5’CATCACACATATCTGTAAATCTC TGCCCCTGTTAGA-3’) Co-amplification of the betaglucuronidase gene ... different chronic diseases, including CHC [9-14] Blood sampling Venous peripheral blood from each patient and healthy control was drawn into tubes containing ethylenediaminetetraacetic acid Peripheral ... MA, Carreño V: In vivo and in vitro induction of MxA protein in peripheral blood mononuclear cells from patients chronically infected with hepatitis C virus J Infect Dis 1999, 180:262-267 Erickson...

Ngày tải lên: 12/08/2014, 02:20