c is displayed in the compass window

EXPLORING THE C# INTERFACE2You can view the last five searches that you made in the Index window potx

EXPLORING THE C# INTERFACE2You can view the last five searches that you made in the Index window potx

... Customize window ‚ Click to select a I The command appears in the custom toolbar I You can access the command button in the custom toolbar by clicking command category — Drag the command you ° Click ... Form1.cs Form1.cs I The custom toolbar appears in the middle of the parent window You can click and drag to another area ‡ Right-click the custom toolbar · Click the Commands tab in the Customize window ... pertain to the C# topic You can limit the search even more by checking one of the four search criteria check boxes These check boxes let you search words in specific locations, such as in a title,...

Ngày tải lên: 12/08/2014, 09:23

32 385 0
Tài liệu Báo cáo khoa học: Cobalamin uptake and reactivation occurs through specific protein interactions in the methionine synthase–methionine synthase reductase complex docx

Tài liệu Báo cáo khoa học: Cobalamin uptake and reactivation occurs through specific protein interactions in the methionine synthase–methionine synthase reductase complex docx

... results in a quenching of the intrinsic flavin fluorescence, suggesting that the flavin chromophore is shielded from the solvent in the protein–protein complex [19] From the fluorescence titration assays, ... quenching of flavin fluorescence, confirming that these two proteins not interact with hMS We have compared the electrostatic potentials for the surface of the CPR FMN domain (in the region of the ... of MS During primary turnover, the homocysteine-binding domain (dotted barrel) and the CH3-H4-folate binding-domain (black barrel) form discrete complexes with the cobalamin-binding domain (dark...

Ngày tải lên: 18/02/2014, 08:20

10 699 0
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx

Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx

... CTAGATCTAAC-3¢ and 5¢-AGGCCCCGGGTCACCTC CTAGCTAGAATTC-3¢ for a1; and 5¢-AGGTGATC ATATGCTTCTAGAGAAGAGTGAAATA-3¢ and 5¢-AG AGGATCCTCAGCCCATTTGGAGGGCGG-3¢ for b1 In each case, the forward primer introduced ... MKIVCRCNDV, respectively The N-terminal aminoacid sequence of the a2 subunit corresponded to the underlined amino-acid sequence within MEIVRINEHPILD from the putative protein encoded by the predicted ORF ... another, as yet unknown, dyel-proDH is produced by this organism In the present study, we identified the gene encoding this other enzyme, expressed it in Escherichia coli, and examined the characteristics...

Ngày tải lên: 20/02/2014, 01:20

11 550 0
Tài liệu Báo cáo khoa học: "THERE STILL IS GOLD IN THE DATABASE MINE" potx

Tài liệu Báo cáo khoa học: "THERE STILL IS GOLD IN THE DATABASE MINE" potx

... Research ~ All of this is not to say that all the research problems in computational linguistics can be carried on even in the extended context of database access It is rather a plea for careful individual ... of the current interest in database interfaces and in which considerable research is needed Large, shiny nuggets of theory are waiting to be discovered by enterprising computational linguists! ... this need not be the case The point of the spectrum is that there is a continuum from "database" to "knowledge base", and that the supposed limitations of one arise from the application of techniques...

Ngày tải lên: 21/02/2014, 20:20

2 432 0
Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc

Báo cáo khoa học: Different roles of two c-tubulin isotypes in the cytoskeleton of the Antarctic ciliate Euplotes focardii Remodelling of interaction surfaces may enhance microtubule nucleation at low temperature doc

... maps of the E focardii c- T1 and c- T2 nanochromosomes Coding, noncoding regions, introns, and telomeres (C4 A4 ⁄ G4T4) are indicated in the key The coding sequences of the E focardii c- T1 and c- T2 ... centrosome function in the closed orthomitosis of the micronucleus We did not detect c- tubulin or microtubules in the macronucleus of E focardii, in contrast to reports that c- tubulin and microtubules ... GATA-transcription factor binding site in the c- T2 promoter, although other processes might also be involved In multicellular organisms, GATA-binding factors play critical roles in development, including...

Ngày tải lên: 07/03/2014, 04:20

16 468 0
Processing Fluency and Aesthetic Pleasure: Is Beauty in the Perceiver''''s Processing Experience? pptx

Processing Fluency and Aesthetic Pleasure: Is Beauty in the Perceiver''''s Processing Experience? pptx

... strings, indicating that grammatical letter strings are easier to process In combination, the available findings again indicate that increased preference is associated with increased fluency: ... of the same coin Processing Fluency The Concept of Processing Fluency The processing of any stimulus can be characterized by a variety of parameters that are nonspecific to its content, such ... perceptual fluency theory of beauty can account for phenomena that are difficult to conceptualize in the context of other theories Specifically, a perceptual fluency theory helps explain the interplay...

Ngày tải lên: 16/03/2014, 18:20

20 514 0
Báo cáo khoa học: Oxidative stress is involved in the permeabilization of the inner membrane of brain mitochondria exposed to hypoxia/reoxygenation and low micromolar Ca2+ Lorenz Schild1 and Georg Reiser2 doc

Báo cáo khoa học: Oxidative stress is involved in the permeabilization of the inner membrane of brain mitochondria exposed to hypoxia/reoxygenation and low micromolar Ca2+ Lorenz Schild1 and Georg Reiser2 doc

... upon brain ischemia ⁄ reperfusion A second factor determining mitochondrial damage upon ischemia ⁄ reperfusion is the increase in cytosolic Ca2+ concentration, which causes swelling of mitochondria, ... the presence or absence of 3.5 lm Ca2+ The mitochondrial incubations were carried out in the cuvette of the luminescence spectrophotometer at 30 C in the presence of dichlorofluorescin (DCFH) and ... suggests that the mitochondrial injury is caused by opening of the mPTP There is evidence that ADP inhibits opening of the mPTP by occupying binding sites located in the inner and outer mitochondrial...

Ngày tải lên: 16/03/2014, 22:20

9 433 0
Báo cáo khoa học: An E3 ubiquitin ligase, Synoviolin, is involved in the degradation of immature nicastrin, and regulates the production of amyloid b-protein doc

Báo cáo khoa học: An E3 ubiquitin ligase, Synoviolin, is involved in the degradation of immature nicastrin, and regulates the production of amyloid b-protein doc

... the cell membrane No increase in the cell surface NCT level in cells overexpressing Synoviolin was observed (Fig 5D) Discussion In this study, we showed that Synoviolin is involved in the intracellular ... Synoviolin is involved in the degradation of nicastrin T Maeda et al NCT is one of the essential cofactors of the c- secretase complex We therefore investigated the effect of the Synoviolin-mediated ... generation of this mature NCT species [9] In addition, NCT is critical for the stability and trafficking of other c- secretase components, and NCT affects Ab production [11] Interestingly, the cellular...

Ngày tải lên: 23/03/2014, 04:20

9 562 0
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

... apoptosis TCDD induces nPKC kinase activity in L-MAT cells Fig Effects of protein kinase C (PKC) inhibitors on the 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced apoptosis of L-MAT cells L-MAT cells ... fractionating L-MAT cells into cytosol and particulate fractions and then examining the translocation of each of the nPKC isoforms in L-MAT cells treated with TCDD (by 905 PKCh in TCDD-induced signaling ... site The L-MAT cell apoptosis induced by TCDD was completely inhibited in the presence of 20 lm myr-PKCh PPI, as shown in Fig 4, confirming the involvement of nPKCs PKCh kinase activity is completely...

Ngày tải lên: 23/03/2014, 13:20

13 426 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

... phosphoprotein XR_004667 4332 Upper primer Probe Lower primer mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC ... CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC ... CATGTCGTGGAGGAAACGCAGATGTC mCARP.R TGGCACTGATTTTGGCTCCT mp65NFjB.F GGCGGCACGTTTTACTCTTT mp65NFjB.P CGCTTTCGGAGGTGCTTTCGCAG mp65NFjB.R TCAGAGTTCCCTACCGAAGCAG mMurf1.F AGGGCCATTGACTTTGGGAC mMurf1.P...

Ngày tải lên: 29/03/2014, 21:20

16 462 0
Hướng dẫn khắc phục lỗi “username is not in the sudoers file...” trong Ubuntu doc

Hướng dẫn khắc phục lỗi “username is not in the sudoers file...” trong Ubuntu doc

... /etc/sudoers.backup sudo nano /etc/sudoers - Và nhập đoạn mã vào file hiển thị: # # This file MUST be edited with the 'visudo' command as root # # Please consider adding local content in /etc/sudoers.d/ ... bị chỉnh sửa t c động C n file /etc/sudoers hệ thống không l c đầu, bạn th c thao t c giống bư c – nhấn Enter hiển thị thông báo Finished Sau đó: - Tại giao diện dòng lệnh, gõ: sudo cp /etc/sudoers ... #includedir /etc/sudoers.d - Nhấn Ctrl + O để lưu nội dung Ctrl + X để đóng file - Tiếp theo, khởi tạo m c phân quyền cho file sudoers vừa tạo: chmod 440 /etc/sudoers - Và cuối gán tài khoản c n...

Ngày tải lên: 30/03/2014, 00:20

4 863 1
Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

... double-stranded probe containing an MEF2-binding site was prepared by annealing complementary synthetic oligonucleotides The sense sequence was 5¢-GATTCTTCTATAAATAGGTACTTTCCCTCA-3¢ The sequence of the mutated ... in MEF2B knocked-down cells In addition, a PGF2a-induced increase in O2– production as well as the basal level of cellular O2– was reduced in these clones compared with the mock-transfected cells ... BC079361; genomic sequence, rat chromosome 16) In accord with this observation, the PGF2a- or PDGF-induced increase in MEF2B mRNA was almost completely abolished in ATF-1 knockeddown clones These...

Ngày tải lên: 30/03/2014, 03:20

9 452 0
Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc

Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc

... was constructed according to the following strategy Two partially complementary oligonucleotides 5¢-CGCGGAATTCTTAGTGATGGTGATG GTGATGTGTTGAAGCTTCCTTCAGGG-3¢ and 5¢-CAT CACCATCACCATCACTAAGAATTCCGCGATAGAA ... strains were incubated in the presence or absence of CuCl2 The control experiment (in the absence of CuCl2) was performed in the presence of NEM instead of CuCl2 Cross-linking conditions are described ... Table The three mutants displayed a slight increase in the doubling time with lactate as carbon source An interesting point was the low amount of rho– cells in cultures in comparison with the null...

Ngày tải lên: 31/03/2014, 01:20

10 550 0
Báo cáo khoa học: ISC1-encoded inositol phosphosphingolipid phospholipase C is involved in Na+/Li+ halotolerance of Saccharomyces cerevisiae pptx

Báo cáo khoa học: ISC1-encoded inositol phosphosphingolipid phospholipase C is involved in Na+/Li+ halotolerance of Saccharomyces cerevisiae pptx

... product, B-ceramide were run as references isc1D + pDZ6 was a transformant of the isc1D mutant with the ISC1 containing plasmid, pDZ6 cell homogenate The characteristics of the Disc1::HIS5 deletion ... can1) The HIS5 insertion cassette used for ISC1 disruption was isolated, by short flanking homology PCR, from plasmid pFA6a-HIS3MX containing the Schizosaccharomyces pombe HIS5 gene [31] The cassette ... protein Ó FEBS 2002 4038 C Betz et al (Eur J Biochem 269) phosphatase calcineurin [23–25] The target protein of calcineurin action in yeast is the zinc-finger transcription factor Crz1p [38,39] Crz1p...

Ngày tải lên: 31/03/2014, 09:20

7 239 0
Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx

Báo cáo khoa học: NMR and MS evidences for a random assembled O-specific chain structure in the LPS of the bacterium Xanthomonas campestris pv. Vitians A case of unsystematic biosynthetic polymerization potx

... is also reflected in the chemical shifts of C1 of Fuc3NAc, which is downfield in comparison to the other fragments A change in the / and w angles has been shown to give rise to a difference in the ... are visible This suggests that Fuc3NAc is linked to both the reducing end as well as to the nonreducing end of the Rha-backbone of the oligosaccharide, i.e the structure is Fuc3NAc–Rha–Rha–(Fuc3NAc)–RhaOH ... nonreducing end of the acceptor chain at the cytoplasmic face [20] In some cases a single enzyme catalyses the formation of more linkages and this, of course, poses difficulties for the maintenance...

Ngày tải lên: 31/03/2014, 09:20

9 455 0
what is what in the nanoworld. a handbook on nanoscience and nanotechnology, 2004, p.350

what is what in the nanoworld. a handbook on nanoscience and nanotechnology, 2004, p.350

... of the under- atomic engineering tiw 13 tip Figure 6: Schematic of the sliding proccss: a and e - imaging, h - connecting, c - sliding, d disconnecting lying surface Howevcr, the presence of the ... is a current between the reservoirs where c is the electronic charge, o is the vclocity component along the conducting channel at the Fermi surface, d n l d p is the density 01states in the channel ... between the stretching force constant for a molecular bond and thc bond length ballistic conductance - a characteristic of ideal hallistic transport of charge carriers in nanostructures It is deduccd...

Ngày tải lên: 04/06/2014, 14:50

350 338 0
what is what in the nanoworld. a handbook on nanoscience and nanotechnology, 2008, p.541

what is what in the nanoworld. a handbook on nanoscience and nanotechnology, 2008, p.541

... H2N CH2 CH NH2 O Glutamic acid (Glu - E) COOH HOOC CH2 CH2 CH Glutamine (Gln - Q) COOH H 2N NH2 NH2 C CH2 CH2 CH O COOH NH2 Basic amino acids Arginine (Arg - R) HN CH2 CH2 CH2 CH C NH Histidine ... 3C CH CH COOH H 3C NH2 COOH COOH CH Methionine (Met - M) COOH H 3C S (CH2)2 NH2 NH2 CH COOH NH2 Acidic amino acids and their amides Aspartic acid (Asp - D) HOOC Asparagine (Asn - N) C CH2 CH COOH ... general helical orbit around the magnetic field lines approaches the surface within the same distance on each cycle If the radiofrequency coincides with the cyclotron frequency, the electron can resonantly...

Ngày tải lên: 04/06/2014, 15:18

541 500 0
báo cáo hóa học:" Sperm protein 17 is expressed in the sperm fibrous sheath" ppt

báo cáo hóa học:" Sperm protein 17 is expressed in the sperm fibrous sheath" ppt

... Translational Medicine 2009, 7:61 Background The interaction of capacitated spermatozoa with the zona pellucida (ZP) of the oocyte is a complex process involving a high number of spermatic molecules [1] ... loosely attached spermatozoa Sperm collection, viability, hypoosmotic swelling test and ZP binding were performed in accordance with the instructions in the WHO laboratory manual for the examination ... as the mean percent ± SD of all spermatozoa Samples The study, using human subjects, was carried out in accordance with the guidelines of the Ethics Committee of the hospitals involved Transmission...

Ngày tải lên: 18/06/2014, 15:20

5 435 0
báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

... GTGAGCCCAA CCACACAGCTGC-3' MCP-5: GenBank Accessions # AC012294, NC_000077 5'-AAACACAGCTTAAAATAAAACAAAGAGGACGTGAGG-3' 5'-CAACTACAGAATCGGCGTGTGCCA-3' 5'-TCACGTGCTGTTATAATGTTGTTAAGCAGAAGATTCACGTCC-3' ... C- 3' 5'-GCTCGCTCAGCCAGATGCAAT-3' 5'-TGGGTTGTGGAGTGAGTGTTC-3' 5'-CCT GTG GCC-TTG GGC CTC AA-3' 5'-GAG GTG CTG ATG TAC CAG TTG G-3' 5'-GTC ACC CAC ACT GTG CCC ATC T-3' 5'-ACA GAG TAC TTG CGC TCA GGAG-3' ... HIF-1 binding (5'-TCTGTACGTGACCACACTCACCTC-3') and a mutant DNA sequence (5'-TCTGTAAAAGACCACACTCACCTC-3') [15,16] were purchased from Santa Cruz Biotech Inc (CAT # sc-2625, Santa Cruz, CA) and...

Ngày tải lên: 19/06/2014, 22:20

15 541 0
báo cáo hóa học: " Nogo receptor is involved in the adhesion of dendritic cells to myelin" ppt

báo cáo hóa học: " Nogo receptor is involved in the adhesion of dendritic cells to myelin" ppt

... outside the CNS, perhaps in the activation of DCs or in homing of DCs to specific tissues This is supported by the findings of the non-myelin associated proteins B cell activating factor (BAFF) ... HLA-DRPerCP (BD Biosciences), CD86-FITC (BD Biosciences), CCR7-PE (R&D Systems, Minneapolis, MN, USA), CD83-FITC (BD Biosciences), CD11b-PE (BD Biosciences), CD1a-FITC (BD Biosciences), and CD1 1c- PE ... untreated DCs expressed CD83 The percentage of cells expressing CD83 increased significantly to 90.0 ± 2.2% after addition of maturation cocktail, indicating successful DC maturation Significant increases...

Ngày tải lên: 19/06/2014, 22:20

12 666 0
w