... lcc 3.5 gcc 2.7.2 Alpha OSF/1 3.2A lcc 4.0 gcc 2.6.3 cc MIPS R3000 IRIX 5.3 lcc 3.5 gcc 2.6.3 cc MIPS R3000 Ultrix 4.3 lcc 3.5 gcc 2.5.7 Pentium Windows 95 Windows NT 3.51 Microsoft Visual C/ C++ ... respect to the standards, and it also describes how to write “clean C — C code that can be compiled with C+ + compilers Jaeschke (1991) condenses the essence of Standard C into a compact dictionary ... programming seems to encourage accuracy, precision, and clarity C Interfaces and Implementations: Techniques for Creating Reusable Software C Interfaces and Implementations: Techniques for Creating Reusabl...
Ngày tải lên: 04/09/2013, 22:04
... iteration and decision constructs, narrowing and widening operations, and the unchecked keyword Chapter 4: Core C# Programming Constructs, Part II This chapter completes your examination of the core ... this chapter, however, is to acquaint you with a number of NET centric building blocks, such as the Common Language Runtime (CLR), Common Type System (CTS), Common Language Specification (CLS), and ... NET 4.0 Dynamic Language Runtime (DLR) and the C# 2010 dynamic keyword Later chapters will examine some fairly advanced topics, such as object context, CIL code, and the construction of in-memory...
Ngày tải lên: 04/10/2013, 14:07
C:Documents and SettingsCHI THOIMy Documentsbao cao danh gia thuc hien chuan KTKN cac mon hoc vadoi moi PPDH.doc
... d c vào đầu năm thời điểm năm h c th c thường xuyên, góp phần nâng cao chất lượng giáo d c Vi c th c cam kết đem lại hiệu thiết th c Công t c th c bàn giao chất lượng lớp cho lớp : khảo sát chất ... h c, kì thi h c kì, nhà trường th c cho GV khối kết hợp coi thi với lớp C ng t c th c thường xuyên góp phần giảm thiểu tiêu c c thi c II-Vi c th c đổi phương pháp dạy h c tiểu h c từ năm h c ... tích c c h c sinh, chủ động điều chỉnh dạy h c sát với th c tiễn lớp dạy Kĩ sử dụng đồ dùng dạy h c nhuần nhuyễn, hiệu ( chưa sử dụng máy chiếu: chưa c thiết bị) Về h c sinh : chất lượng học...
Ngày tải lên: 14/10/2013, 23:11
Bài soạn C:Documents and SettingAdminMyDocu ments/inh tinh - hoaKhoa học lớp 5 - Hoa.ppt
... nư c chảy I/ Sử dụng lượng gió -Vì c gió? -Không khí chuyển động từ nơi c nhiệt độ cao đến nơi c nhiệt độ thấp sinh gió - Nêu ví dụ t c dụng lượng gió tự nhiên Làm cho chuyển động, c trụ c ... lượng nư c chảy: -Con người sử dụng lượng nư c chảy vi c gì? - Dùng s c nư c để tạo dòng điện ph c vụ sinh hoạt vùng núi - Xây dựng nhà máy thủy điện - Làm quay bánh xe nư c (c n nư c) Thứ ngày ... h c: Kiểm tra c : 1/ Khí đốt tự nhiên khai th c từ đâu? -Sử dụng khí sinh h c 2/ Vì chất đốt cháy c lợi gì? thể ảnh hưởng-Khí đốt tự nhiên khai th c từ mỏ đến môi trường? sử dụng cháy sinh C c...
Ngày tải lên: 29/11/2013, 11:11
professional c# 4 and NET 4 (wrox)
... oC31 OC35 OC36 OC37 OC39 OC40 oC43 OC44 oC48 oC49 oC50 OC50 OC52 O oC53 OC53 OC54 OC54 OC56 OC58 OC59 O O O O O XliV oC59 OC61 OC62 OC62 oC66 oC75 oC77 oC77 OC78 OC79 OC80 OC82 OC83 OC84 ... O oC233 oC234 oC235 oC236 OC236 OC239 oC242 OC242 OC246 oC249 oC254 oC255 oC257 OC257 OC258 OC258 OC259 oC261 OC262 OC266 oC266 OC266 OC267 OC268 OC269 OC269 oC271 oC272 OC272 OC273 OC273 OC274 ... OC140 OC141 oC145 OC145 OC146 OC146 OC147 oC149 OC150 OC150 OC151 OC151 OC152 OC152 oC153 OC153 OC153 oC155 oC157 oC158 oC159 OC159 OC160 OC161 OC161 OC163 oC163 OC164 S O O O O OC165 OC166...
Ngày tải lên: 24/01/2014, 19:28
Tài liệu Báo cáo khoa học: 3T3-L1 adipocyte apoptosis induced by thiazolidinediones is peroxisome proliferator-activated receptor-c-dependent and mediated by the caspase-3-dependent apoptotic pathway doc
... medium and visualized by confocal microscope (Leica TCS SP2 Confocal Microscope System, Leica microsystems, Wetzlar, Germany) Ten microscopic fields were captured for each sample by fluorescence microscopy, ... Akt-1 reverse, 5¢-TTGTC CTCCAGCACCTCAGG-3¢; CD36 forward, 5¢-TCCAGC CAATGCCTTTGC-3¢; CD36 reverse, 5¢-TGGAGATTAC FEBS Journal 277 (2010) 687–696 ª 2009 The Authors Journal compilation ª 2009 FEBS ... 5¢-AAAGACA GCTCCTCCTCGAAGGTT-3¢; and aP2 reverse, 5¢-TGA CCAAATCCCCATTTACGC-3¢ Standard curves were generated with 10-fold serial dilutions ranging from ⁄ 10 to ⁄ 10 000 of the reverse transcription...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: The resident endoplasmic reticulum protein, BAP31, associates with c-actin and myosin B heavy chain Analysis by capillary liquid chromatography microelectrospray tandem MS ppt
... 0.5% (v/v) formic acid The collected fractions were combined and the peptides were dried in a speed-vac and kept at )20 C until use was achieved by manually excluding tandem mass spectra of poor ... amino acid sequence analysis of (A) the myosin heavy chain nonmuscle type B (GeneBank accession P35580) and of (B) nonmuscle c- actin (GeneBank accession P02571) by LC-lESI-MS/MS All amino acids ... immunoprecipitation with the antiFlag Ig, however, c- actin could be detected only in the BAP31 immunocomplex In particular, the immunocomplex Fig The pre-apoptotic BAP31 complex specifically recruits c- actin...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... genes CytOX5a and CytOX5b, coding for the two isofoms Va and Vb, parallels that of genes CYC1 and CYC7, which encode iso-1 and iso-2 of yeast cytochrome c, respectively CytOX 5a and CYC1 are coexpressed ... aerobic conditions (O2 > 0.5 lM), whereas CytOX 5b and CYC7 are co-expressed under hypoxic (O2 < 0.5 lM) and heme deficient conditions [11] The coexpression of speci c subunit V and cytochrome c isoforms ... in the subunit content and catalytic activity of the cytochrome c oxidase complex from different tissues and different cardiac compartments Biochim Biophys Acta 1371, 71–82 24 Schagger, H & von...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT ... CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled ... halfvelocity constant As we have determined the OmcA and OmcB concentrations present in omcB– and omcA– cells, respectively, and because omcA– omcB– double mutant cells completely lack Fe(III) reductase...
Ngày tải lên: 07/03/2014, 09:20
Perinatal Mortality Edited by Oliver C. Ezechi and Karen Odberg-Petterson potx
... low income countries of sub Saharan Africa and South central Asia are inadequate obstetric and neonatal care, and harmful home care practices, such as the discarding of colostrum, the application ... Ernährungszustandes Munch Med Wochensch, 68, pp 580-588 Rosso, P., Winick, M (1974) Intrauterine growth retardation A new systematic approach based on the clinical and biochemical characteristics of this condition ... Battaglia, FC., Lubchenco LO (1967) A practical classification of newborn infants by weight and gestation age Pediatrics, 71, pp 159-170 Berkő, P (1992) A study of the incidence, causes and consequences...
Ngày tải lên: 07/03/2014, 20:20
C# in Depth: What you need to master C# 2 and 3 pptx
... 3.4 Advanced generics 85 Static fields and static constructors 86 How the JIT compiler handles generics 88 Generic iteration 90 Reflection and generics 92 ■ ■ 3.5 ■ Generic collection classes ... help to encourage you to consider separation of concerns 13 Evolution in action: examples of code change C# C# C# Strong coupling between condition and action Both are hard-coded Separate condition ... C# 1 code and evolving it, seeing how C# 2 and allow the source to become more readable and powerful We look at the historical context in which C# has grown, and the technical context in which it...
Ngày tải lên: 14/03/2014, 20:20
Báo cáo khoa học: Vanadium-induced apoptosis of HaCaT cells is mediated by c-fos and involves nuclear accumulation of clusterin pptx
... either pcDNA or a vector carrying nCLU (C1 20), selected in G418 to generate HaCaT NeoT and HaCaT nCLU (C1 20), respectively, and total proteins (T), cytoplasmic extracts (C) , nuclear extracts (N) and ... keratinocyte pooled cell lines Generation of the nCLU (C1 20) plasmid and nCLU (C1 20)-expressing HaCaT cells Using speci c primers: (C1 20, HindIII, forward, 5¢-CGAA TTCGCGGAAGCTTCATGTCTGTGGACT-3¢; and ... 3¢-ATCAGATGGATCCTTATCACTCCTCC CGGTGCTTTTTGC-5¢), the C1 20 cDNA encoding for the minimal Ku70-binding domain of nCLU (120 amino acids of the C- terminus) was amplified from the original pACT2– C1 20...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: Plant oxylipins: Plant responses to 12-oxo-phytodienoic acid are governed by its specific structural and functional properties ppt
... transgenic tobacco cell culture By contrast, JA–Ile treatment had no detectable effect on the cellular Ca2+ content of the examined cell culture system [44] Although OPDA and JA both contribute ... feedback loop, inducing the expression of detoxification enzymes such as GSTs and lipid transfer proteins OPDA can be released from cyclo-oxylipin-galactolipids Cyclic oxylipins not occur exclusively ... the biochemical factors accounting for leaf closing and opening directly affect K+ channel activity, thereby modulating turgor pressure in specialized flexor cells [48–50] By analyzing a rice mutant...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx
... microfilaments [28] HD-caveolae as sites of fatty acid uptake and triacylglycerol synthesis We have previously used biochemical analysis, fluorescence confocal microscopy and electron microscopy ... VHD-caveolae and HD-caveolae and LD-caveolae; and (e) closed caveolae without cell surface access have been demonstrated in the plasma membrane by electron microscopy [5] We not know the function ... identification [5] of two morphologically distinct classes of caveolae at the plasma membrane ) canonical caveolae that are open to the extracellular space and caveolae lacking access from the cell...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khóa học: C-, 15N- and 31P-NMR studies of oxidized and reduced low molecular mass thioredoxin reductase and some mutant proteins docx
... mutant TrxR C1 38S mutant TrxR C1 38S mutant + PMA C( 2) C( 4) C( 4a) C( 5a) C( 6) C( 7) C( 7a) C( 8) C( 8a) C( 9) C( 9a) C( 10a) C( 10a) C( 10b) C( 10 c) C( 10d) C( 10e) N(1) N(3) N(5) N(10) 159.8 163.7 136.2 136.4 ... mutant TxR C1 38S mutant TxR C1 38S mutant + PMA C( 2) C( 4) C( 4a) C( 5a) C( 6) C( 7) C( 7a) C( 8) C( 8a) C( 9) C( 9a) C( 10a) C( 10a) C( 10b) C( 10 c) C( 10d) C( 10e) N(1) N(3) N(5) N(10) 150.6 157.0 105.2 136.0 ... reduction, and those of C( 6) and C( 7) are upeld shifted by a p-electron density increase coming from N(5) and N(10), respectively In contrast the chemical shifts of C( 2), C( 4a), C( 5a), C( 9a) and...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt
... GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc ... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864 Q Y V P Q G P ♦ (245) tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc ... cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag 1058 B -20 AGCAGCCTGGACCTGCCAAG -1 ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học: Cellular retinol-binding protein type II (CRBPII) in adult zebrafish (Danio rerio) cDNA sequence, tissue-specific expression and gene linkage analysis pptx
... MgCl2, 0.4 lM sense primer (5¢-TTCGCCACCCGTAAGATC-3¢), 0.4 lM antisense primer (5¢-AAACTCCTCTCCAATGACG-3¢), 0.2 mM Fig Nucleotide sequence of a cDNA clone coding for a zebrafish CRBPII The complete ... hybrid panel was scored and then analyzed according to the directions at (http://mgcdh1.nichd.nih.gov:8000/zfrh/beta.cgi) PCR primers (5¢-CCAGCACATCCAGCTTC-3¢) and (5¢-GCCTGTTTGGAGCATTAG-3¢) (see ... with other CRBPs, CRABPs, and FABPs The amino-acid sequences of zebrafish CRBPII (ZbfshCRBPII; GenBank Accession number AF363957), chicken CRBPII (ChickCRBPII [43]), pig CRBPII (PigCRBPII; P50121),...
Ngày tải lên: 17/03/2014, 11:20
Lecture notes on c algebras and quantum mechanics [jnl article] n lamdsman
... k A vector space with a norm which is complete in the associated metric (in the sense that every Cauchy sequence converges) is called a Banach space We will denote a generic Banach space by the ... vector annihilated by all representatives of A A representation is called cyclic if its carrier space H contains a cyclic vector for this means that the closure of (A) (which in any case is a closed ... space X which is locally compact (in that each point has a compact neighbourhood) The space C0 (X ) consists of all continuous functions on X which vanish at in nity in the sense that for each...
Ngày tải lên: 17/03/2014, 14:41
Andrew koenig c traps and pitfalls article
... effect, the names malloc and Malloc become equivalent In other words, the library function malloc is effectively replaced by the Malloc function above, which when it calls malloc is really calling ... associated with a function call For example, getchar and putchar are usually implemented as macros to avoid having to call a function for each character of input or output 6.1 Macros are not Functions ... Multi-character Tokens Some C tokens, such as /, *, and =, are only one character long Other C tokens, such as /* and ==, and identifiers, are several characters long When the C compiler encounters a / followed...
Ngày tải lên: 19/03/2014, 14:05
Andrew koenig c traps and pitfalls
... assume here that the lexical and syntactic details of the language are well understood and concentrate on semantic details INTRODUCTION CHAPTER Chapter recognizes that a C program is often made ... a given character, the next token is taken to include the longest string of characters which could possibly constitute' a token." Tokens (except string or character constants) never contain embedded ... you can choose whichever expresses your intent most clearly 3.4 Eschew synecdoche A synecdoche (Sin-ECK-duh-key) is a literary device, somewhat like a simile or a metaphor, in which, according...
Ngày tải lên: 19/03/2014, 14:05