c initialize array of pointers in constructor

Báo cáo y học: "Serum cystatin C levels to predict serum concentration of digoxin in Japanese patients

Báo cáo y học: "Serum cystatin C levels to predict serum concentration of digoxin in Japanese patients

Ngày tải lên : 31/10/2012, 17:08
... Digoxin, Serum concentration, Heart failure, Renal clearance 1. Introduction Cystatin C (Cys -C) is a non-glycosylated cationic protein of 13.3 kDa, belonging to the cystatin superfamily of cysteine ... Okumura K. Factors influencing the prediction of steady state concentrations of digoxin. Biol Pharm Bull. 2001; 24(4):403–408. 22. Cockcroft DW, Gault MH. Prediction of creatinine clearance from ... level of Cys -C to diagnose a certain class of heart diseases, including heart failure, has recently been suggested based on the fact that the serum level of Cys -C, not of Cr, was higher in such...
  • 5
  • 523
  • 0
Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

Ngày tải lên : 17/02/2014, 14:20
... permission in writing from the publisher. Engineering Mechanics - Statics Chapter 2 Problem 2-15 Resolve the force F 1 into components acting along the u and v axes and determine the magnitudes of ... permission in writing from the publisher. Engineering Mechanics - Statics Chapter 2 Since cos 180deg φ − () cos− φ () = , F R F 1 2 F 2 2 + 2 F 1 F 2 cos φ () += From the figure, tan θ () F 1 sin ... by any means, without permission in writing from the publisher. Engineering Mechanics - Statics Chapter 2 Problem 2-24 Resolve the force F into components acting along (a) the x and y axes,...
  • 1.1K
  • 1.1K
  • 2
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx

Ngày tải lên : 19/02/2014, 05:20
... to check the in uence of cisplatin adducts in the vicinity of p53DBS. Again, the effects of DNA cis-platination on p53(1–363) binding to these substrates were dependent on the presence of cisplatin- reactive ... tran- scription factor involved in cell cycle control [1–3]. It plays a crucial role in preventing malignant transfor- mation of a cell via induction of cell cycle arrest or programmed cell death in ... Fojta 1 1 Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic 2 Masaryk Memorial Cancer Institute, Brno, Czech Republic The tumor suppressor protein p53 is...
  • 14
  • 597
  • 0
Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf

Tài liệu Báo cáo khoa học: Extended half-life upon binding of destabilized intrabodies allows specific detection of antigen in mammalian cells pdf

Ngày tải lên : 19/02/2014, 18:20
... GCG-3Â and 5Â-CCATCCGAATTCTCACTACACATTGAT CCTAGCA GAAGC-3Â were used for the PCR amplication of the C- terminal region of d1-EGFP corresponding to the mouse ornithine decarboxylase PEST sequence ... 5Â-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3Â and 5Â-CA TGCCAAACGT TCGCGA CCGC CCTGAC GGCGAT TA TCGGAGTTCGGACA-3Â into the unique SpeI restriction site. p13R4-DP was obtained by replacing the B10 tag of the p13R4 construct with annealed ... (amino acids 422–461 [18]). The B10 tag was subsequently added to the resulting plasmid by cloning the following annealed oligo- nucleotides 5Â-CTAGTCGTCCGAACTCCGATAATCGC CGTCAGGGCGGTCGCGAACGTTTAG-3Â...
  • 14
  • 483
  • 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Ngày tải lên : 20/02/2014, 01:20
... Paris, France). The primers used were VB1: 5Â-AAACATATGA GCATGAGCTACCACCTGGACC-3Â and VB3: 5Â-CTCG AGCTTCACAAGAAACTTCTGC-3Â. The PCR fragment was cleaved by the restriction enzymes Nde1 and Xho1 and inserted ... amount of radioactivity incorporated into the nucleic acids was measured after TCA precipitation and plotted against the incubation time in minutes. T. Astier-Gin et al. Binding and replication of ... of a chimeric cDNA clone of hepatitis C virus genotype 1b are infec- tious in vivo. Virology 244, 161–172. 22 Mottola G, Cardinali G, Ceccacci A, Trozzi C, Bartholomew L, Torrisi MR, Pedrazzini...
  • 15
  • 597
  • 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Ngày tải lên : 07/03/2014, 04:20
... on pro- teins that contain exposed clusters of hydrophobic ami- noacyl residues, resulting in an increase in fluorescence [39]. ANS binding fluorescence of wild-type and mutant Hsp25 reached a maximum ... Protein precipitation was monitored by light scattering at 360 nm. Assays were performed in duplicate. The precipitation of 45 lm insulin from bovine pancreas in the presence of increasing concentrations ... decrease in polarity of the C- terminal extension may also facili- tate interaction between the extension and hydro- phobic chaperone binding sites, resulting in the binding sites being less accessible...
  • 14
  • 417
  • 0
Báo cáo khoa học: The essential tyrosine-containing loop conformation and the role of the C-terminal multi-helix region in eukaryotic phenylalanine ammonia-lyases docx

Báo cáo khoa học: The essential tyrosine-containing loop conformation and the role of the C-terminal multi-helix region in eukaryotic phenylalanine ammonia-lyases docx

Ngày tải lên : 07/03/2014, 12:20
... that metabolic channeling of (E)-cin- namic acid requires the close association of speci c forms of PAL with C4 H on microsomal membranes [63]. The site of phosphorylation of French bean PAL has ... the product (E)-cinnamic acid is hydroxylated at the para-position by cinnamate-4-hydroxylase (C4 H), in conjunction with NADPH:cytochrome P450 reductase (CPR). The coordinated reactions catalyzed by ... As homotetrameric PAL contains four catalytically active sites according to the crystal structures [40–42], it is probable that the isolated isoforms of the bean PAL after chromatofocusing are enzymes with increasing number...
  • 16
  • 502
  • 0
C++ Lab 15 Review of Arrays, Array of Objects and Vector Dr. John Abraham, Professor doc

C++ Lab 15 Review of Arrays, Array of Objects and Vector Dr. John Abraham, Professor doc

Ngày tải lên : 08/03/2014, 00:20
... discuss with you dealing with array is the card shuffling program. Here we have an array with names of a deck of card. We do not actually shuffle this array, instead we create an array of integers ... calculated by adding all valid scores stored in the array and dividing by the number of scores. The deviation of each score is obtained by subtracting the score from the mean. Since this program ... Vector Class The vector is more flexible than arrays as it can grow in size dynamically. The array can be accessed using the subscript operator just like in array. However, to add an element into...
  • 7
  • 416
  • 1
Báo cáo Y học: Identification of residues in the PXR ligand binding domain critical for species specific and constitutive activation docx

Báo cáo Y học: Identification of residues in the PXR ligand binding domain critical for species specific and constitutive activation docx

Ngày tải lên : 08/03/2014, 16:20
... I282Q (forward), 5Â-CAACGCCCAGCATACCCAGCAGT-3Â for Q404H (forward), 5Â-CAACGCCCAGGCAACCCAG CAGT-3Â for Q404A (forward), 5Â-TGAACCTCAGCT GGCACATCTA-3Â for I282Q (reverse), 5Â-ACTGCTG GGTATGCTGGGCGT-3Â for ... Q285I, 5Â-TCAATGCTCAGCAGACCCAGCGGC-3Â for H407Q, 5Â-TCAATGCTCAGGCCACCCAGCG GC-3Â for H407A. The selection restriction site mutation was created by primer 5Â-GTAGCTGACTGGAGCATG CAT-3Â mutating a unique ... performed in C3 A cells (ATCC, CRL-10741, lot i 1414101) in 6-well plates. C3 A cells were seeded at a concentration of 5 · 10 5 cells in each well and incubated for 24 h at 37 °Cin2mLgrowth medium containing...
  • 9
  • 552
  • 0
Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt

Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt

Ngày tải lên : 15/03/2014, 09:20
... obtained by labeling 100 pmol of HPLC-puried primer WT (5Â-AATTGATCCCGCCCG CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA ACATGGCGCCGCTGCGGGGC-3Â) using 50 lCi of [c- 32 P]ATP (3000 Ciặ mmol )1 ; GE Healthcare) ... The oligonucleotide WT was used as a template for amplification of a 70 bp PCR product with [5Â- 32 P]-labeled S70ds UP (5Â-AATT- GATCCCGCCCGCCTC-3Â) and S70ds DN (5Â-GCCCCG CAGCGGCGCCATGTT-3Â) ... extracts, consistent with the truncation affecting part of domain X. Inter- estingly, mutants with shorter C- terminal truncations (DC14 and DC21) displayed no detectable splicing activity in vivo....
  • 11
  • 398
  • 0
Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt

Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt

Ngày tải lên : 16/03/2014, 14:20
... 5Â-GGGGTCTAGATCACTCTAT CACAAAGTAAACAAAGAGAGT-3Â, respectively) result- ing in a 599-bp PCR product. Inserting the EcoRI · XbaI- digested PCR fragment behind the GFP sequence in the pPOMC-GFP vector ... are now in the position to obtain more understanding of the normal physiological role of PrP C , e.g. by examin- ing the effect of mutant PrP C proteins on melanotrope cell functioning, including copper ... panel). A B C Fig. 1. Intermediate pituitary-speci c fluorescence in Xenopus embryos transgenic for GFP–PrP C . (A) Schematic representation of the linear injection fragment pPOMC–GFP–PrP containing the...
  • 16
  • 431
  • 0
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt

Ngày tải lên : 16/03/2014, 16:20
... 2201, E-mail: cigr@nmr.mpibpc.mpg.de Abbreviations: SP -C, surfactant-associated protein C; hSP -C, human SP -C; pSP -C, porcine SP -C; rSP -C, recombinant human SP -C; rSP -C (FFI), FFI variant of recombinant ... concentra- tions can be obtained in dodecylphosphocholine micelles in which SP -C is stable for months in its a-helical form [8]. The surfactant consists of  1% by weight of SP -C [31]. The concentration of ... NN (i,i+1) connectivities clearly show the a-helical structure of rSP -C (FFI). In addition, 3 J NHa coupling constants are summarized, with small circles indicating couplings < 5.0 Hz and large circles...
  • 10
  • 426
  • 0
Báo cáo Y học: Elucidation of the role of fructose 2,6-bisphosphate in the regulation of glucose fluxes in mice usingin vivo 13 C NMR measurements of hepatic carbohydrate metabolism docx

Báo cáo Y học: Elucidation of the role of fructose 2,6-bisphosphate in the regulation of glucose fluxes in mice usingin vivo 13 C NMR measurements of hepatic carbohydrate metabolism docx

Ngày tải lên : 17/03/2014, 17:20
... is indicative of activated 6-phosphofructo-1-kinase, which can lead to increased 13 C labeling at the triose level. Such a mechanism can lead to increases in labeling of glycogen C6 even in the presence ... start of glucose infusion. For the calculation of glycogen C6 changes, data acquired within 1 h of the start of the glucose infusion was not included to avoid any in uence of transient changes in ... in the intact liver in vivo. Second, during infusion of [1- 13 C] glu- cose, label incorporation was observed not only into the C1 of glycogen but also the C6 , which can only occur by label scrambling...
  • 9
  • 465
  • 0
Naveen toppo, hrishikesh dewan   pointers in c  a hands on approach 2013

Naveen toppo, hrishikesh dewan pointers in c a hands on approach 2013

Ngày tải lên : 19/03/2014, 14:11
... cache memories as they are faster than DRAM. Also, there exist ã dedicated instruction cache and data cache in some architectures, such that instruction code will reside in the instruction cache ... on how various kinds of expressions can be used to access a particular index of an array. Chapter 4 contains an explanation of how pointers can be used to initialize static strings and manipulate ... help of function pointers. Chapter 7 is an explanation of usage of the function pointers concept. Chapter 8 contains details about le handling. How le pointers are used to manipulate les using...
  • 161
  • 1.1K
  • 1
Role of C-Reactive Protein and Procalcitonin in Differentiation of Tuberculosis from Bacterial Community Acquired Pneumonia potx

Role of C-Reactive Protein and Procalcitonin in Differentiation of Tuberculosis from Bacterial Community Acquired Pneumonia potx

Ngày tải lên : 22/03/2014, 18:20
... Journal of Internal Medicine Vol. 24, No. 4, December 2009 Table 2. Diagnostic validity of C- reactive protein (CRP) and procalcitonin (PCT) in differentiating pulmonary tuberculosis from bacterial community-acquired ... significant positive correlation was detected between the CRP and PCT concentrations ( r=0.648, p=0.01). Diagnostic accuracy for discriminating TB from bacterial CAP In the ROC curve analysis, the CRP ... protein; Pneumonia, community acquired; Procalcitonin; Tuberculosis Received: December 13, 2008 Accepted: March 4, 2009 Correspondence to Choon-Taek Lee, M.D. Department of Internal Medicine,...
  • 6
  • 515
  • 2