c find row in datatable and update

... aa 3 -type cytochrome c oxidases of Rhodobacter sphaeroides and Paracoccus deni- trificans. Subunit 2 forms part of the docking site for cytochrome c and binds Cu A , the first electron acceptor. Subunit ... Rapid screening of cytochromes of respiratory mutants of Saccharo- myces cerevisiae – application to the selection of strains containing novel forms of cytochrome c oxidase. Eur. J. Biochem. 213, 137–145. 11. ... of cytochrome c oxidase subunits 1 and 3 in Saccharomyces cerevisiae: assembly defect and compensation. Biochim. Biophys. Acta 1554, 101–107. 10. Brown, S., Colson, A M., Meunier, B. & Rich,...

Ngày tải lên: 23/03/2014, 21:20

Ngày tải lên: 07/08/2014, 10:21

... risks accompanying the method are fat and air embolism and infection [4]. Aminocaproic acid, desmopressin acetate, aprotinin, tranexamic acid, phytonadione and vasopressin are hemostatic drugs ... associated with hemoglobin increase in gynecolo- gic cancer patients receiving chemotherapy as a weekly dose [28]. Table 1 Clinical studies evaluating blood conservation methods in major pelvic ... Thorough peer review ã No space constraints or color gure charges ã Immediate publication on acceptance ã Inclusion in PubMed, CAS, Scopus and Google Scholar ã Research which is freely available for...

Ngày tải lên: 13/02/2014, 06:20

... homocysteine-binding domain (dot- ted barrel) and the CH 3 -H 4 -folate binding-domain (black barrel) form discrete complexes with the cobalamin-binding domain (dark grey circle). hMS is inactivated ... Interaction of Escherichia coli cobalamin-dependent methionine syn- thase and its physiological partner flavodoxin: binding of flavodoxin leads to axial ligand dissociation from the cobalamin cofactor. ... & Penner-Hahn JE (2001) Characterization of the zinc sites in cobalamin-independent and cobalamin-depen- dent methionine synthase using zinc and selenium X-ray absorption spectroscopy. Biochemistry 40 ,...

Ngày tải lên: 18/02/2014, 08:20

... questions and show that both a novel C- terminal actin-binding submodule (CABS) containing a novel actin monomer binding verprolin homology 2 C- terminal (VH2 -C) domain and a sec- ond submodule comprising ... life cycle of actin patches in mating yeast. J Cell Sci 114, 1505– 1513. 9 Pelham RJ Jr & Chang F (2001) Role of actin polymer- ization and actin cables in actin-patch movement in Schizosaccharomyces ... of cortical actin patches. Cortical actin-patch polarization in vrp1D (AMY88) cells carrying YCplac111 vector (vect), pAM236 expressing C- Vrp1p 364)817 (C- Vrp1p 364)817 ), pAM896 expressing C- Vrp1p 364)760 (C- Vrp1p 364)760 )....

Ngày tải lên: 18/02/2014, 16:20

... lacking the cisplatin-reactive motifs or containing multiple guanine doublets and ⁄ or triplets (Fig. 7), were used to check the in uence of cisplatin adducts in the vicinity of p53DBS. Again, ... IACs, 10% of 1,3-GNG IACs and interstrand crosslinks, and another 2–3% of monofunctional adducts. It has been found that cisplatin cytotoxicity is related mainly to the IACs that induce significant ... cisplatin adducts (see Fig. 1), the cisplatin inhibitory effects could be explained by DNA damage within the p53DBS. It is known that the cisplatin IACs induce considerable DNA bending and untwisting...

Ngày tải lên: 19/02/2014, 05:20

... present in the sequence are the two copper A (amino acids 86–96) and copper B (amino acids 258–294) binding motifs common to most tyrosinase sequences [3] that contain five of the six copper-bind- ing ... 1–36 Pre-pro-tyrosinase 518 amino acids Core domain 37–357 C- terminal extension amino acids 358–518 Copper binding motif Arg40 Phe453 Cys84 Tyr349 Tyr347 Copper binding motif Pro-tyrosinase 481 amino acids Core ... acids Core domain 36–357 C- terminal extension amino acids 358–518 Copper binding motif Arg40 Phe453 Cys84 Tyr349 Tyr347 Copper binding motif Core tyrosinase 320 amino acids Core domain 36–357 Copper...

Ngày tải lên: 06/03/2014, 11:20

... of Csaki 6 Wiener Process and Invariance Principle 6.1 Four lemmas 6.2 Joining of independent random walks 6.3 Definition of the Wiener process 6.4 Invariance Principle 7 Increments ... (mod 2) which proves (2.5). (2.6) can be obtained by a direct calculation. (2.9) Chapter 5 Levy Classes 5.1 Definitions The LIL of Khinchine tells us exactly (in certain sense) how ... n and (ii) S, 2 (1 - c) b;' i.0. a.s. Having in mind this form of the LIL, Levy asked how the class of those functions (or monotone increasing functions) f(n) can be characterized...

Ngày tải lên: 06/03/2014, 19:20

... guideline is divided into sections for ease of reading. For each section the layout is similar and contains the following parts. ● Clinical introduction sets a succinct background and describes ... Physicians (RCP). The NCC-CC undertakes commissions received from NICE. A multiprofessional partners’ board inclusive of patient groups and NHS management governs the NCC-CC. NCC-CC Technical ... of up-to-date guidance and accord- ingly NICE have asked the National Collaborating Centre for Chronic Conditions (NCC-CC) to produce this guideline, amalgamating and updating the previously published...

Ngày tải lên: 08/03/2014, 14:20

... rapid and direct on-line identification and quantification of the vitamin E and γ-oryzanol components in rice bran and germ. KEYWORDS: Rice bran; rice germ; γ-oryzanol; vitamin E; LC-MS/MS INTRODUCTION Free ... spectrum of 7a could not be obtained in LC − MS/MS analysis because of its very low concentration in the dichloromethane fraction. Quantification of Vitamin E and γ -Oryzanol Components in Rice ... bran without intact germ; ESI-MS, electrospray ionization mass spectrom- etry; API-ES, atmospheric pressure interface-electrospray; ICC, ion-charge control; CID, collision-induced dissociation; frag,...

Ngày tải lên: 15/03/2014, 15:33

... staining. Oligonucleotides used in this study were: PF, 5Â-CGGGATC CGGTGGCGACGACTCCTGGAGCCC-3Â;PR,5Â-CG GGATCCCAACTGGTAATGGTAGCGACCGGC-3Â; P2-1, 5Â-ATGGAYATHGCIACIACICARGC-3Â;P2-2, 5Â-TAGCAACTCATTCGTCACTGTC-3Â; P2-3, ... 5Â-GGA ATTCTAGATATCGTCGACAATTTGTGTTACTACC AAAATC-3Â;P2-4,5Â-GGAATTCGTCGACGCGTTAA AAAAGATAGCAGCATTGACAC-3Â;P3-1,5Â-ATGG GIAAYGARGTIGAYATHG-3Â; P3-2, 5Â-CTAGACC TATGTTTTTCTCCATCC-3Â; P4-1, 5Â-CCIAARAAYA ARAAYAARGG-3Â; ... 5Â-CAGATAGGAAGAGGG GCAAGGA-3Â;P4-3,5Â-GGAATTCTAGATATCGTC GACTTATCTTCAGAACTTGTTGC-3Â; P4-4, 5Â-GGA ATTCGTCGACGCGTTTTTCAACAAATCATCATAT A-3Â;TAG1,5Â-GGAATTCTAGATATCGTCG-3Â; TAG2, 5Â-GGAATTCGTCGACGCG-3Â. Computer...

Ngày tải lên: 17/03/2014, 09:20

... latent infection and active disease, there is concern about increasing use of IGRAs for active tuberculosis in high-burden countries. In this systematic review focused on individuals living in low- ... from traditional ROC curves in allowing accuracy to vary by each individual study (ie, allowing for random effects and, thus, asymmetry in the plotted curve) and by discouraging extrapolation ... tuberculin skin test for active tuberculosis diagnosis. Conclusions. In low- and middle-income countries, neither the tuberculin skin test nor IGRAs have value for active tuberculosis diagnosis in...

Ngày tải lên: 22/03/2014, 18:20

... also confirmed by orcinol staining. In each case, we have identified two main glycopeptide fractions, eluted at 47 min for fraction 1 and at 56 min for fraction 2, which correspond to the glycosylation ... 115 and 160 Da, correspond exactly to the masses of glycine, serine, aspartic acid and carb- oxamidomethylated cysteine, respectively, amino acid sequence GSDC, that corresponds to the glycosylation ... GlcNAc- containing glycans in tLf mainly reflects differences in N-acetylglucosaminidase activities that govern the biosyn- thesis of paucimannose-type glycans, after maturation of the N-glycans...

Ngày tải lên: 31/03/2014, 07:20

... Rha residues. Each oligosaccharide was carrying 0–2 Fuc3NAc substituents in accordance with the compositional and methylation analyses proving that the polysaccharide is composed of a linear rhamnan backbone ... fraction 1, the cluster of ions originating from octasaccharides contained ions from sodium adducts of Rha 8 ,Rha 7 Fuc3NAc, Rha 6 (Fuc3NAc) 2 and Rha 5 (Fuc3- NAc) 3 , whereas the sodium adduct ... refractom- eter, and dried (15 mg). Molecular modelling Molecular modelling was carried out using the consistence valence force field in the Discover program [9]. The monosaccharide residues were constructed...

Ngày tải lên: 31/03/2014, 09:20

Ngày tải lên: 12/05/2014, 15:38

Ngày tải lên: 12/05/2014, 17:36