c departs from the ansi standard
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... P jacquemontii lectin is sufficiently evident from its inhibition and hemagglutinatin study The lectin is unique from that of other sialic acidspeci c lectins O-Acetyl sialic acid-speci c lectin ... O-acetyl sialic acid The HAI results when summarized suggest that the crab lectin was sialic acid-speci c with a high affinity for O-acetylated NeuAc Discussion The presence of naturally occurring ... fractions collected on ice in polypropylene tubes containing 100 lL of 100 mM CaCl2 at a rate of 0.3 mLÆmin)1 The presence of calcium chloride was required in the collected fractions because the...
- 8
- 616
- 0
Báo cáo khoa học: Kinetic characterization of methionine c-lyases from the enteric protozoan parasite Entamoeba histolytica against physiological substrates and trifluoromethionine, a promising lead compound against amoebiasis ppt
... ‘nested PCR’, using the first PCR product as template To make use of the BamHI site in the vector and the XbaI site in the EhMGL1 gene, the product of the nested PCR was replaced with the corresponding ... Technology, for the synthesis of TFM and constructive discussions This work was supported in part by Grants-in-Aid for Scienti c Research from the Ministry of Education, Culture, Sports, Science ... excessive amounts of bacteria or host cells This can be interpreted as follows to explain the regulatory mechanism of the intracellular Met concentration Under physiological Met or Cys concentrations,...
- 13
- 406
- 0
Báo cáo khóa học: Structural and functional comparison of 15S- and 15R-specific cyclooxygenases from the coral Plexaura homomalla potx
... acid sequence of novel COX is 97% identical with the COX sequence from the same coral species collected in the Florida Keys forming 15R-configuration products (Fig 1) Similar to the 15R-speci c ... (Eur J Biochem 271) characterize the COX enzyme from the S-variety of P homomalla, compare its primary structure and catalytic properties with its 15R-speci c counterpart, and locate the residues ... products formed from [1 4C] arachidonic acid with wild-type and mutant P homomalla 15SCOX expressed in Sf9 cells Incubations of [1-1 4C] arachidonic acid with recombinant coral COX proteins were carried...
- 6
- 414
- 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... at the branching point Elucidation of the structure of the O-speci c polysaccharide by NMR spectroscopy The 1 3C NMR spectra of OPS-I and OPS-II were essentially identical, and therefore only the ... polysaccharide was studied further The 1 3C NMR spectrum (Fig 2) contained signals for four anomeric carbons in the region d 94.8–99.8, three CH3 -C groups (C6 of Rha and Fuc), one C- CH2 -C group ... Hydrolysis conditions: A, 2-M CF3CO2H, 120 C, h; B, 10-M HCl, 80 C, 0.5 h; C, 0.5-M CF3CO2H, 100 C, h DA, O-deacetylated; OPS, O-speci c polysaccharide; SD, Smith-degraded GLC detector response...
- 7
- 478
- 0
Tài liệu Báo cáo khoa học: Pyrimidine-specific ribonucleoside hydrolase from the archaeon Sulfolobus solfataricus – biochemical characterization and homology modeling doc
... Leu Ile Leu a Calculated using the program DSSP b Calculated according to Facchiano et al [48] c Calculated according to Facchiano et al [48] d Calculated using the program AVP sequence identity, ... with the expected mass calculated from the amino acid sequence The identity of the protein was checked by N-terminal sequencing and was conrmed by MALDI-MS analysis of the HPLC puried protein The ... using the crystal structure of CU-NH from S solfataricus Escherichia coli pyrimidine-specic NHs Yeik [29] and Ybek [30] as templates The structure provided insight into the active site architecture...
- 15
- 557
- 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C The PCR reaction was done as described above The amplified PCR product was ... with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT GGT GGT GGT GGT GCA ... Phenol 4-Mercaptophenol p-Cresol 4-Aminophenol 3-Hydroxyanthranilic acid Tyramine p-Tyrosol p-Coumaric acid o-Coumaric acid Ferulic acid Aniline (–)-Epicatechin (+)-Catechin hydrate Pyrocatechol Pyrogallol...
- 14
- 650
- 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...
- 15
- 597
- 0
Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx
... (C) phosphocellulose, (D) dsDNA-cellulose, and (E) and ssDNA-cellulose columns The detailed description of each chromatographic procedure is given in the text The dotted line indicates the KCl ... activity of PDH120 by actinomycin C1 (B), ethidium bromide (C) , daunorubicin (D) and nogalamycin (E) The DNA helicase reactions were performed in the presence of increasing concentrations of the ... by including different concentrations of actinomycin C1 (Fig 6B), ethidium bromide (Fig 6C) , daunorubicin (Fig 6D), and nogalamycin (Fig 6E) in the standard helicase reactions The titration curve...
- 11
- 573
- 0
Addressing Air Emissions from the Petroleum Refinery Sector Risk and Technology Review and New Source Performance Standard Rulemaking pptx
... to the respiratory tract, cataracts, cancer 17 Health Effects of Other Pollutants Compound Mechanism Health Effect Volatile Organic Compounds Combine with NOx Significantly reduce lung function ... represents the highest excess cancer risk for a p g receptor from the refinery source category with a 70 year period exposure period taking into account the distance from the refinery to the receptor ... depressurization work practice standard for delayed coking units (DCU) The NOX limit for fluid catalytic cracking units (FCCU) The particulate matter (PM) limit for FCCU 10 EPA’s decision not to promulgate...
- 52
- 355
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... the heme (Fig 4D) From solvent accessibility calculations using the program naccess v2.1.1 (http://wolf.bms.umist.ac.uk/naccess) the position of the K99 side chain in conformer A results in the ... solved by molecular replacement using the program molrep [56] from the CCP4 program suite [57] using the ferricyt c- 550 structure from P denitrificans (PDB code 1cot [15]) as the search model A solution ... studies of cyt c- 550 Fig Overlay of the main-chains of three bacterial c- type cytochromes with the highest structural homology to P versutus cyt c 550 Yellow P denitrificans cyt c- 550 (1cot, 1.7...
- 15
- 509
- 0
Báo cáo khoa học: Characterization of oligosaccharides from the chondroitin/dermatan sulfates 1 H-NMR and 13 C-NMR studies of reduced trisaccharides and hexasaccharides doc
... CS060# and CS#60# Residue Carbon CS040# (p.p.m.) CS060# (p.p.m.) CS#60# (p.p.m.) DUA (C) C1 C2 C3 C4 C5 C6 C1 C2 C3 C4 C5 C6 CH3 C O C1 C2 C3 C4 C5 102.83 71.54 67.51 109.41 147.01 – 102.97 55.02 ... 4-sulfated GalNAc residue Table Carbon chemical shift Dd values between CS040# and CS060# Residue Carbon Calculated (p.p.m.) Observed (p.p.m.) DUA (C) C1 C2 C3 C4 C5 C1 C2 C3 C4 C5 C6 +1.1 +0.9 ... of CS is a repeating disaccharide of glucuronic acid (GlcA) and N-acetylgalactosamine (GalNAc) [-4)GlcA(b1– 3)GalNAc(b1-]n, which may be O-sulfated on the C4 and ⁄ or C6 of GalNAc and C2 of GlcA...
- 11
- 481
- 0
Báo cáo " PROTECTING AGRICULTURAL CROPS FROM THE EFFECTS OF TROPOSPHERIC OZONE EXPOSURE: Reconciling Science and Standard Setting in the United States, Europe, and Asia" ppt
... statistics could not be used for other locations or Crop Broccoli (Brassica oleracea L.), lettuce (Lacuca dativa L.), and onion (Allium cepa L.) Soybean (Glycine max L Merr cv Clark) Cotton (Gossypium ... the United States The European approach has centered around the concept of a “critical level” (CL), which is based on a cumulative exposure above a cutoff concentration below which only an acceptable ... into the plant rather than just ambient O3 concentration or cumulative exposure This article focuses on research that has been conducted on the exposure of agricultural crops to enhanced concentrations...
- 33
- 542
- 0
Herbert schild c++ from the ground up
... to consult your Visual C+ + documentation for details.) To compile MyProg.cpp using C+ + Builder, use this command line C: \ >bcc32 Sample.cpp The output from a C+ + compiler is executable object code ... Inheritance is the process by which one object can acquire the properties of another object The reason this is important is that it supports the concept of hierarchical classification If you think ... with C The reason for this is simple: C+ + is built upon the foundation of C In fact, C+ + is a superset of C (Indeed, all C+ + compilers can also be used to compile C programs!) Specifically, C+ +...
- 625
- 1,818
- 0
released from the grip of what he carried freedom from his c
... another member of the infantry, carries not only hatchet with which he cuts off a thumb of an enemy Harry Dobbins carried his girlfriend's panties around his neck, and Dave Jansen carried ... not now a factor" (288) O'Brien's use of the term "freedom birds" is appropriate when referring to the jets that take troops away because it carries them away, far away from where they don't want ... seemingly reaching out to him, she in fact had no deep feeling for him Lieutenant Jimmy Cross, in the end, realized the mistakes he's made He sees that he has unknowingly threatened the lives of the men...
- 2
- 245
- 0
Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx
... Jolla, CA, USA) with forward primer 5¢-GAAACGATGC ATTTGTCCTATGCCGACCGTGCGTC-3¢ and reverse primer 5¢-GACGCACGGTCGGCATAGGACAAATGCA TCGTTTC-3¢ The sequence of the second PCR product was also confirmed ... bound to the catalytic pocket As described above, for E coli GGT it has been well established that the catalytic reaction proceeds in the active site pocket, which is shielded from solvent by the ... anthracis CapD catalyzes the cleavage of the c- glutamyl bond but, unlike GGTs, transfers the poly -c- d-glutamic acid to the peptidoglycan cell wall, and is therefore involved in linking the capsule...
- 10
- 375
- 0
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
... interaction may be an artifact caused by the crystallization of lactose-liganded EW29Ch because: (a) in the other EW29Ch molecule of the crystal structure (each crystal contained two molecules ... increasing concentrations of each sugar For the progressive chemical-shift changes of EW29Ch under conditions of fast exchange on the chemical-shift timescale, 15N and 1HN chemical-shift changes ... interacting with the protein, because the resonance signals of the glucose residue overlapping with those of the galactose residue within the lactose affected the subtraction of the free induction...
- 11
- 458
- 0
Báo cáo khoa học: Novel c-carboxyglutamic acid-containing peptides from the venom of Conus textile docx
... substrate to the carboxylase and also activates the enzyme The discovery of c- carboxylated conotoxins and, more recently, the cloning and characterization of the c- carboxylase from cone snails ... (5¢-CTCTGAGGGCGCCAAACATGTCG-3¢) and GSP2 (5¢-CGACATGTTTGGCGCCCTCAGAG-3¢) in 5¢- and 3¢-RACE PCR that employed a C textile RACE library as the template Amplification parameters were as indicated by the manufacturer ... Gla(3)–TxVI contain a motif –cCCS– that is found in four other Gla-containing peptides, TxVIIA from C textile, c- PnVIIA from C pennaceus, d7a from C delessertii and as7a from C austini [1,21,22,29] Conotoxins...
- 10
- 437
- 0
Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx
... 5¢-ATIACITGGGA (C/ T)ACITA (C/ T)TA (C/ T)(A /C) G-3¢; band D Fig 1A, 5¢-TT (C/ T)GA (C/ T)CA(A/G)ATITA (C/ T)CA (C/ T )C- 3¢; and a generic vector primer (T7 primer), 5¢-GTAATACGACTCACTATAGGGCG-3¢ PCR products ... (http://www.bdbiosciences.com/clontech/) and the genespeci c primer: 5¢-CCTCGTCAATGGAGTACTCGTAG CCATCAG-3¢ The amplified product was cloned in pCR2.1 as described for DNA sequencing DNA sequences were determined by standard ... (C- terminal) restriction sites: Forward, 5¢-CGCGCTGCA GGTCATGAGAAATATGAAGGA-3¢; Reverse, 5¢-GC GCGTCGACTGAATAGTTTTGCAAGACGTACTG-3¢ They were designed to allow the amplified sequences encoding the proproteins...
- 12
- 458
- 0
DISTRIBUTION AND PACKAGING OF STUDENT FINANCI AIDI,: SOMEr EVIDEN~C FROM THE SURVEY 0F THE HIGH SCHOOL CLASS.OF 1972 potx
... Student Characteristics Definted: SES (Socioeconomic Status): An index composed of five components: 1) father's education; 2) mother's education; 3) parents' income; 4) father's occupation; 5) ... RACIAL/ETHNIC GROUP: Collapsed grouping based on respondent's answer to race/ethnic question The category "Hispanic" includes those who answered Mexican-American or Chicano, Puerto Rican, or other ... Latin American origin "Oriental or Asian-American" andl "Other" were excluded from the race/ethnic distribution ACHIEVEMENT/ABILITY: From information collected in the Student's School Record Information...
- 11
- 245
- 0
Báo cáo khoa học: C-mannosylation in the hypertrehalosaemic hormone from the stick insect Carausius morosus doc
... reference For the glycosylated peptide, the molecular mass calculated from the chemical structure is still almost in the error range of the molecular mass calculated from the diffusion constant for ... 1 3C chemical shifts from random-coil values The latter were calculated on the basis of the random-coil values of completely denatured model peptides [15], which were corrected for the effects ... of the random-coil values for the a-protons, a-carbons and b-carbons Graphs show the difference between the chemical shifts Dd of Cam-HrTH-I and Cam-HrTH-II and the sequence corrected random coil...
- 11
- 404
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25