c d broad on the explanatory gap
Apress - Learn Objective-C on the Mac (2009)
Ngày tải lên :
07/12/2012, 15:47
... Hello Objective -C folder To create the project, start by launching Xcode You can find the Xcode application in /Developer/Applications We put the Xcode icon in the Dock for easy access You might ... that holds Objective -C code and will be processed by the Objective -C compiler File names ending in c are handled by the C compiler, and cpp files are the province of the C+ + compiler (In Xcode, all ... easier to read Deeply nested constructs are often confusing and hard to understand, and they’re a good place for bugs to hide The Comparison Itself The next two lines of code compare a couple of...
- 362
- 743
- 13
Giúp định hướng ôn thi đại học khối C-D
Ngày tải lên :
09/06/2013, 01:26
... t c phẩm đoạn trích khái quát văn h c sử.) C c vấn đề d nh cho tất thí sinh, d h c theo chương trình c (chương trình C i c ch giáo d c áp d ng từ 2000-2008) hay (gồm khái quát t c giả, 28 t c ... d , c ch d ng số quan hệ từ, c ch xây d ng đề c ơng diễn thuyết, c ch viết văn tổng kết… E.PHẦN VĂN H C NƯ C NGOÀI: 1.Chỉ c c u hỏi đề thi Tốt nghiệp THPT Không c c u hỏi đề thi Đại h c- Cao ... th c văn h c nư c Khi làm thi Đại h c- Cao chủ yếu d ng để so sánh với văn h c Việt nam Chẳng đẳng ,c c kiến th c văn h c nư c hạn so sánh Đám tang lão Gôriô (Banz c) với Hạnh ph c chủ yếu d ng...
- 6
- 604
- 13
Period: 41- Lesson C.ON THE MOVE(1-3)
Ngày tải lên :
24/10/2013, 05:11
... • *Choose the right words • 1.Ba……….to work by motorbike • a.go b.to go c c.goes • 2.Lan’s father travel to work……… car • a.in b .on c c.by • 3.I go to school………foot • a.by b .on c. in b • 4………does ... Mrs.Huong By car c) Nam By bus g) Mr Ha d) Nga By bike h) Miss.Chi By walks By train Practice: *Make questions and answer: He/ go/ school/ bike - How does he go to school? - He goes to school ... to school ? Lien I go to school by bike Thu I go to school by motorbike Tuan Hoa I go to school by bus I go to school by car Huong I walk to school Match mean of transportation with the correct...
- 20
- 401
- 1
Cấu trúc đề văn ôn thi khôi C, D
Ngày tải lên :
21/12/2013, 19:14
... văn h c Câu III.a Theo chương trình chuẩn (5,0 điểm) Nội dung kiến th c liên quan đến t c giả, t c phẩm yêu c u phần c u (đã nêu trên) C u III.b (theo chương trình nâng cao) Ngoài nội dung kiến ... dung kiến th c yêu c u thí sinh chương trình chuẩn, bổ sung thêm t c phẩm, t c giả sau: - Đời thừa (trích) – Nam Cao - Nam Cao - Xuân Diệu - Tương tư – Nguyễn Bính - Nhật ký tù – Hồ Chí Minh - ... (trích) – Nguyễn Trung Thành - Những đứa gia đình (trích) – Nguyễn Thi - Chi c thuyền xa (trích) – Nguyễn Minh Châu - Hồn Trương Ba, da hàng thịt (trích) – Lưu Quang Vũ C u II (3,0 điểm): Vận d ng...
- 3
- 3.5K
- 21
Tài liệu Đề tài " On the classification problem for nuclear C -algebras " pdf
Ngày tải lên :
16/02/2014, 06:20
... Elliott’s conjecture remained unclear The counterexamples above suggested the addition of the real rank, and such a modification would not have been without precedent: the discovery that the pairing ... Let X and Y be compact connected Hausdorff spaces, and let K denote the C -algebra of compact operators on a separable Hilbert space Projections in the C -algebra C( Y ) ⊗ K can be identified with ... 1.1; in Section we prove Theorem 1.2; Section demonstrates the complexity of the Cuntz semigroup, and discusses the relevance of Z-stability to the classification program Acknowledgements The author...
- 17
- 468
- 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
Ngày tải lên :
20/02/2014, 01:20
... using the primer set, RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) These primers were designed based on the sequence retrieved from the GenBank database ... under accession number L04347, and NcoI or BamHI sites (underlined) and the initiation codon (bolded) were introduced into the sequences The cDNA subcloned into pCR2.1TOPO was first subjected ... and RTnI116R (5¢-GAGCATGGCGGGAT CCTACATGCGCAC-3¢) and RTnI96F (5¢-GCTGGAGG CCATGGACCAGAAGC-3¢) and RTnI181R, respectively (BamHI ⁄ NcoI sites and termination ⁄ initiation codons are indicated...
- 12
- 514
- 0
Tài liệu Báo cáo Y học: Studies on the nonmevalonate pathway of terpene biosynthesis The role of 2C-methyl-D -erythritol 2,4-cyclodiphosphate in plants docx
Ngày tải lên :
22/02/2014, 07:20
... hexane/ethylacetate (1 : 1; v/v) The red-colored fraction (400–480 mL) was collected and concentrated under reduced pressure The residue was dissolved in 100 mL of chloroform Purification of phytoene Fig Diversion ... from C annuum In each experiment, the sample volume was 150 mL Conc., concentration; Sp radioact., speci c radioactivity Proffered precursors [2-1 4C] cMEPP [1-3H]MEP Sp radioact (mCi·mmol21) Conc ... Based on chemical shift values and coupling constants, the compound was identified as 2C- methyl -D -erythritol 2,4-cyclodiphosphate (see [26] for NMR data of the authentic compound) The absence...
- 9
- 572
- 0
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx
Ngày tải lên :
22/02/2014, 07:20
... of these positions were changed from an acidic side chain into the corresponding amide derivative, yielding unequivocal evidence for their contribution in the cytochrome c oxidation reaction Compared ... hand for the docked complex, the interaction domain for cytochrome c on the cytochrome bc1 complex of yeast turned out to be confined to a few residues only [33] Both the mutants H119N and N16 0D ... verify their subunit composition, concentrated and stored at )80 C Steady-state kinetics and determination of the ionic strength dependence Cytochrome oxidase activity was measured with a Kontron...
- 9
- 457
- 1
Báo cáo " Study on the characteristics and catalytic properties of Pt/SBA-15 in the selective oxidation of D-Glucose " potx
Ngày tải lên :
05/03/2014, 11:21
... This condition facilitated the formation of gluconolactone and disaccharide and inhibited the catalyst activity [2] So, we should add alkaline solution continuously to maintain pH value at during ... nanoparticles in the selective oxidation of glucose When the reaction was performed without pH control on PS-1 catalyst, the conversion decreased significantly The pH at the end of the reaction was ... outside the channels of SBA-15 with size of 10-15nm and catalytic activities of these materials decreased pH value also affects directly on the selectivity of gluconic acid product and the best condition...
- 8
- 677
- 0
Báo cáo khoa học: Heterologous synthesis of cytochrome c¢ by Escherichia coli is not dependent on the System I cytochrome c biogenesis machinery ppt
Ngày tải lên :
06/03/2014, 00:20
... sequence deduced from the cloned gene The stretches of the PHCP amino acid sequence used for the design of the PCR primers are underlined with arrows indicating the 5¢ to 3¢ direction The sequences ... as discussed for other cytochromes c [14] In addition, the a-band in the pyridine hemochrome spectrum of reduced PHCP corresponded to 550 nm, which is indicative of the covalent bonding of heme ... arrowhead indicate the positions of the PHCP and PH c5 52 proteins, respectively The band denoted by the asterisk on the right-hand side is the result of nonspeci c staining of the extracts containing...
- 8
- 606
- 0
Learn Ojective-C on the Mac ppt
Ngày tải lên :
06/03/2014, 03:20
... project is located in the 02.01 - Hello Objective -C folder To create the project, start by launching Xcode You can find the Xcode application in /Developer/Applications We put the Xcode icon in the ... object of the message (the green rectangle) is consulted to see what its class is The rectangle class checks its pile of code and gets the address of the draw function Objective -C runs the code ... interface is the description of the features provided by a class of objects For example, the interface for class Circle declares that circles can accept the draw message Note The concept of...
- 371
- 2.1K
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
Ngày tải lên :
07/03/2014, 09:20
... OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT ... Fe(III)-nitrilotriacetic acid concentration, and Ks is the halfvelocity constant As we have determined the OmcA and OmcB concentrations present in omcB– and omcA– cells, respectively, and because omcA– omcB– double ... GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an...
- 11
- 731
- 0
Báo cáo khoa học: Biosynthesis of isoprenoids – studies on the mechanism of 2C-methyl-D-erythritol-4-phosphate synthase pdf
Ngày tải lên :
16/03/2014, 06:20
... Table S6 Conversion ratios and cycles for the IspC reaction containing hydroxyacetone Table S7 Calculated hypothetical cycles for the IspC reaction containing [1,2-1 3C2 ]glycolaldehyde phosphate ... spectroscopy As described above, these initial conditions were rapidly conducive to steady conditions where and were present in very similar concentrations, and the rates of the forward reaction ... ( 1c) This double-labeled species would be detected via satellite lines in the 1 3C- NMR spectrum due to 1 3C1 3C coupling In order to maximize the diagnostic sensitivity, we decided to conduct the experiments...
- 14
- 534
- 0
Báo cáo khoa học: The potent inhibitory activity of histone H1.2 C-terminal fragments on furin doc
Ngày tải lên :
16/03/2014, 13:20
... verified by DNA sequencing The primer pairs for the cloning were as follows: F-h1: 5¢-ccatgggcatgtccgagactgctcctgc-3¢, 5¢-ctcgagcttctttttgggtgca gcctt-3¢; n-h1 : 5¢-ccatgggcatgtccgagactgctcctgc-3¢, ... 5¢-ccatgggcatgtccgagactgctcctgc-3¢, 5¢-ctcgagc aggctcttgagacccagct-3¢; c- h1 : 5¢-ccatgggcgtgagcaagggcacctt g-3¢, 5¢-ctcgagcttctttttgggtgcagcctt-3¢ The expression vectors were transformed into E coli strain BL21 Cells grown ... product was extracted by 0.1% trifluoroacetic acid containing 20% acetonitrile The extract was then lyophilized and purified on a Sephadex G-15 column, equilibrated with 0.1% trifluoroacetic acid The...
- 11
- 286
- 0
Vitamin C đẩy lui cảm lạnh nhanh gấp đôi nếu tập thể dục pptx
Ngày tải lên :
17/03/2014, 18:20
... lớn bị c m lạnh lần năm, trẻ em trung bình bị c m lạnh/năm T c giả nghiên c u, Harri Hemild Elizabeth Chalker đến kết luận: "Vi c bổ sung vitamin C để giảm c m lạnh nói chung thất bại cho thấy ... bị sỏi thận cao nhất, theo nghiên c u xuất Tạp chí JAMA Internal Medicine Hấp thụ lượng lớn vitamin C gây chứng khó tiêu, đ c biệt bạn hấp thụ d y trống rỗng Thừa vitamin gây tiêu chảy làm tăng ... hiện" T c hại vi c hấp thụ nhiều vitamin C Nghiên c u c ng bố cho thấy, bổ sung vitamin C ngày làm tăng gấp đôi nguy bị sỏi thận đàn ông Trong đó, đàn ông bổ sung vitamin C lần ngày c nguy bị...
- 2
- 270
- 0
Business models on the web(c) M.Civilka, 2002 doc
Ngày tải lên :
22/03/2014, 14:20
... related to patents.] (c) M.Civilka Advertising The web advertising model is an extension of the traditional media broadcasting model The broadcaster a web site, provides content and services ... manufacturers to reach buyers directly and thereby compress the distribution channel The manufacturer model can be based on efficiency, improved customer service, and a better understanding of customer ... Preface Business models – the most discussed and the least understood feature of the web The only agreed fact – the web changes traditional business models (c) M.Civilka Preface Bussines model...
- 49
- 313
- 0
CHƯƠNG TRÌNH ÔN THI ĐẠI HỌC KHỐI C - D MÔN NGỮ VĂN 2008 - 2009 ppt
Ngày tải lên :
23/03/2014, 00:20
... thuật đ c đáo sâu s c Ông quan niệm văn trư c hết phải c phong c ch đ c đáo, viết không giống ai, từ chủ đề, nhân vật, kết c u,đến c ch đặt c u d ng từ - Trong phong c ch nghệ thuật NT c chất ... HCM đ c "TNĐL" Quảng trường Ba Đình lịch sử, khai sinh nư c VNDCCH Sau tổng tuyển c 6.1.1946, Người bầu làm Chủ tịch nư c VNDCCH Từ Người đảm nhiệm ch c vụ cao Đảng Nhà nư c, lãnh đạo toàn d n ... sản đ c biệt cho d n t c, nghiệp văn chương đồ sộ Những nét lớn nghiệp văn h c HCM Trong nghiệp lớn lao HCM c di sản đbiệt để lại cho dt c, nghiệp vh c Người để lại cho nhdân ta nghiệp văn chương...
- 16
- 473
- 4
ADDITIONAOLB SERVATIONS ON THE INTERVERTEB RATES(C HEI F''''LYA MM OIITES) OF''''THJEU RASSAICN DC RETACEOOUFS EASTG REENLAND docx
Ngày tải lên :
23/03/2014, 01:21
... family Craspeditidae diphyletic:being and H ectoroceras one section,comprising Kachpurites,Garniericeras and thence the Haploceratidae, while derived f.rom Pseudolissoceras and itself, with Subcraspediles ... ribbed on on Craspedites the one hand, and to the oxycone Garniericeras the other, but showing its ancestry in occasionalfine ribbing of the type (Nikitint)), or the bundled costation stchurowsftli ... angularity of the biconcave lines of growth, and a lower external lobe These di{Ierences seemedunimportant, consideringthe widespreadsimplification of charactersin the Jurassicand especially cretaceous...
- 79
- 214
- 0