c coding rules are specific

Tài liệu C++ Coding Standard Specification doc

Tài liệu C++ Coding Standard Specification doc

... J.P.Wellisch CMS-NOTE 1998/070, CMS-NOTE 1998/071, and CMS-NOTE 1998/072 ALICE C+ + Coding Conventions, I.Hrivnacova, http://www1.cern.ch/ALICE/Projects/offline/CodingConv.html COMPASS C+ + Coding Conventions, ... http://www.cern.ch/Atlas/GROUPS/SOFTWARE/OO/asp/cxx -rules/ FINAL C+ + Coding Standard Introduction Specification Version/Issue: 1.1/5 C+ + Coding Conventions, P.Binko LHCb Computing Note: LHCb 98-049 COMP The CMS coding and ... Of course, constructor and destructor must be implemented as well, see item CB2 Source Status CXX-38, R77, 6.RC, 6.GC, 7.GC, COMP2 Common FINAL page 19 C+ + Coding Standard Coding CL12 Specification...

Ngày tải lên: 22/02/2014, 06:20

60 1,9K 1
C# Coding Standards and Best Programming Practices

C# Coding Standards and Best Programming Practices

... lower case Example: BackColor ackC Camel Casing - First character of all words, except the first word are Upper Case and other characters are lower case Example: backColor ackC Use Pascal casing ... try-catch for each task you perform and enclose only the specific piece of code inside the try-catch This will help you find which piece of code generated the exception and you can give specific error ... Naming Conventions and Standards Note : The terms Pascal Casing and Camel Casing are used throughout this document Pascal Casing - First character of all words are Upper Case and other characters are...

Ngày tải lên: 18/08/2012, 08:47

18 810 1
C# Coding Solutions

C# Coding Solutions

... source code illustrates the Utility class: public class FactoryUtils { public FactoryUtils() { } public static Factory ExceptionFactory() { } public static Factory NullFactory() { } public static ... public void CallIndividualIMarkerImplementation( IMarker child) { IApplicationCallback callback = child as IApplicationCallback; if( callback != null) { callback.AssignParent( this); } callback.Method(); ... IExtension (which subclasses the interface IMarker) is new and represents the specific interface There could be multiple specific interfaces all deriving from IMarker, and each specific interface can have...

Ngày tải lên: 05/10/2013, 11:20

100 355 0
Tài liệu C# Coding Standards doc

Tài liệu C# Coding Standards doc

... discount = this.CalculateCashDiscount( amount ); Trace.Writeline( “Cash discount of {0} applied.”, discount ); break; case PurchaseMethod.CreditCard: // Calculate the credit card discount discount ... PurchaseMethod purchaseMethod ) { // Calculate the discount based on the purchase method float discount = 0.0f; switch( purchaseMethod ) { case PurchaseMethod.Cash: // Calculate the cash discount ... the code If code must be checked in with large sections commented out, include a // TODO: comment above the block commented out describing why it was checked in that way Your Company Name Here Capitalization...

Ngày tải lên: 20/01/2014, 06:20

18 550 8
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

... AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG Construction ... 1025 CD CD + D123 CD CD + D23 CD CD + D3 CD CD + D2 CD CD + D1 CD CD + St2.1 CD CD + St2.2 CD CD + St2.3 CD CD + St3.3 CD CD + St3.2 W366A D1 x D2 D3 CD CD-D123W366A D3 CD CD-D123Y394A D3 CD CD-D123W366AY394A ... following primers: CDfw, AGAGC ATATGCACATTGTTCAT; CDrv, AAACTCGAGTCAC TTGCGTGCAGAGTGATAGAGC The resulting PCR product was digested with NdeI and XhoI and cloned into the pRSFDuet vector (Novagen,...

Ngày tải lên: 22/03/2014, 21:20

13 457 0
Báo cáo y học: "Serum levels of autoantibodies against monomeric C-reactive protein are correlated with disease activity in systemic lupus erythematosus" potx

Báo cáo y học: "Serum levels of autoantibodies against monomeric C-reactive protein are correlated with disease activity in systemic lupus erythematosus" potx

... cyclosporine ACR, American College of Rheumatology; CVI, cerebralvascular insult Pentraxins are phylogenetically conserved pentameric acute-phase proteins that are expressed during infection, systemic inflammation ... surface of human peripheral blood lymphocytes Characterization of lymphocytes reactive with anti-neo-CRP J Immunol 1988, 140:4271-4278 40 Cocca BA, Cline AM, Radic MZ: Blebs and apoptotic bodies are ... Statistically significant differences (P < 0.001) were seen in all three concentrations between C- reactive protein (CRP) and monomeric CRP (mCRP) considering the ability to inhibit anti-CRP binding,...

Ngày tải lên: 09/08/2014, 01:23

8 349 0
C# Coding Standards for .NET potx

C# Coding Standards for .NET potx

... Exceptions Do not use try/catch blocks for flow-control Only catch exceptions that you can handle Never declare an empty catch block Avoid nesting a try/catch within a catch block Always catch ... http://www.lance-hunt.net Lance Hunt C# Coding Standards for NET Coding Style Coding style causes the most inconsistency and controversy between developers Each developer has a preference, and rarely are ... public enum ColorsEnum {…} public class CVehicle {…} public struct RectangleStruct {…} 17 18 19 20 Do not include the parent class name within a property name Example: Customer.Name NOT Customer.CustomerName...

Ngày tải lên: 12/08/2014, 18:22

22 316 0
Báo cáo y học: "Distinct transcriptional MYCN/c-MYC activities are associated with spontaneous regression or malignant progression in neuroblastomas" ppsx

Báo cáo y học: "Distinct transcriptional MYCN/c-MYC activities are associated with spontaneous regression or malignant progression in neuroblastomas" ppsx

... Influence of cluster number 168 genes on outcome Boxplot class −1 10 Class FAM128B Class CCT4 Class CDK4 AHCY ARD1A Class CYC1 Class RPUSD4 Class Hs172673.9 Class HSP90AB1 Class HSPD1 Class PRKY Class ... cMYC at the mRNA and protein levels c- MYC reduction occurs prior to the full expression of ectopically induced MYCN protein (Figure 2a) Accordingly, mRNA levels of direct MYCN /c- MYC targets, such ... by ChIP-chip (Figure 2b) Intriguingly, hierarchical clustering of neuroblastoma cell lines according to the MYCN/cMYC-binding pattern clearly separated MYCN- and c- MYCexpressing neuroblastoma cell...

Ngày tải lên: 14/08/2014, 21:20

14 220 0
C coding convention

C coding convention

... CHUẨN HAY KHÔNG Giới thiệu c ng c hỗ trợ kiểm tra chuẩn viết Code – Cppcheck – C+ + M c đích sử dụng Cppcheck C+ + Coding Convention I.Chuẩn viết code C+ + C+ + (đ c là  "C c ng c ng" hay "xi-plus-plus", IPA: /siː pləs pləs/) là một loại ngôn  ... ngo c 29 C+ + Coding Convention III C ng c kiểm tra tự động code c viết chuẩn hay không Giới thiệu c ng c hỗ trợ kiểm tra chuẩn viết Code – Cppcheck – C+ + - Cppcheck c ng c phân tích mã tĩnh cho ... tích tĩnh th c m c mã nguồn Chương trình hướng theo kiểm tra phân tích tĩnh nghiêm ngặt, đoán tự nhiên 30 C+ + Coding Convention M c đích sử dụng Cppcheck Một lợi ích c ng c phân tích Cppcheck...

Ngày tải lên: 11/03/2016, 22:17

35 1,1K 1
Embedded c coding standard

Embedded c coding standard

... code [C9 0] and [C9 9] Embedded C Coding Standard • The number and severity of bugs introduced by the original programmer can be reduced through disciplined conformance with certain coding practices, ... be enforced during code reviews 29 Embedded C Coding Standard Comments 2.1 Acceptable Formats Rules: a Single-line comments in the C+ + style (i.e., preceded by //) are a useful and acceptable ... only acceptable comment formats can be only partially enforced by the compiler or static analysis The avoidance of commented-out code, for example, must be enforced during code reviews Our choice...

Ngày tải lên: 18/09/2016, 22:46

105 307 0
 Báo cáo y học: "PARP-1 inhibitors: are they the long-sought genetically specific drugs for BRCA1/2-associated breast cancers"

Báo cáo y học: "PARP-1 inhibitors: are they the long-sought genetically specific drugs for BRCA1/2-associated breast cancers"

... by using noncancerous and genetically naïve BRCA1/2-/- ES cells, BRCA2-/- V -C8 hamster cells, and two BRCA2-proficient breast cancer cell lines, MCF-7 and MDA-MB-231, that carried acute suppression ... lethality Can PARP-1 inhibitors specifically kill BRCA1 mutant breast cancer cells? These observations cast significant doubts on the effectiveness and specificity of PARP inhibition on BRCA associated ... cell cycle checkpoint induce genetic instability in BRCA1 exon 11 isoform-deficient cells Mol Cell 1999; 3: 38995 Kim SS, Cao L, Li C, et al Uterus hyperplasia and increased carcinogen-induced...

Ngày tải lên: 31/10/2012, 16:57

7 415 0
Tài liệu C Platform-Specific Event Handling pdf

Tài liệu C Platform-Specific Event Handling pdf

... (l2); Choice c = new Choice (); c. addItem ("Choice 1"); c. addItem ("Choice 2"); c. addItem ("Choice 3"); c. addItem ("Choice 4"); c. addItem ("Choice 5"); add (c) ; add (new Checkbox ("Checkbox")); ... choices Select and deselect a few choices; double-click and single-click selections For the scrollbar Click on each arrow, drag the slider, and click in the paging area (the space between each ... KEY_ACTION  — KEY_ACTION_RELEASE  — MOUSE_DOWN — — Checkbox 10 July 2002 22:28 1010 APPENDIX C: PLATFORM -SPECIFIC EVENT HANDLING Table C 2: Java 1.0 Component Events in Java 1.1 (continued) Component/Events...

Ngày tải lên: 21/01/2014, 06:20

14 324 0
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt

... 5¢-GGACGATGCCACCAGTGCCCTG GACGCCGAGTGCG-3¢ and 5¢-CGCACTCGGCGTC CAGGGCACTGGTGGCATCGTCC-3¢ and complementary primers 5¢-GGATGAGGCTACCAGTGCCCT GGATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATC CAGGGCACTGGTAGCCTCATCC-3¢ for 2V1 ... the complementary primers 5¢-GGACGATGCCACCAGTACTCTG GATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and for TAP2 the complementary primers 5¢-GGATGAGGCTACCAGTAC TCTGGACGCCGAGTGCG-3¢ ... sequence with site-directed mutagenesis Therefore, we used the complementary primers 5¢-GGATGAGGCTACCAGTGC TC TGGACGCCTAG TGCGAGCAGGC-3¢ and 5¢-GCCTGCTCGCACTAGG CGTCCAGAGCACTGGTAGCCTCATCC-3¢ All...

Ngày tải lên: 20/02/2014, 02:21

16 408 0
Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc

Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc

... hepatocytes with ATP or PLC was speci c for certain molecular species, diacyl, alkylacyl and alk-1-enylacyl subclasses were separated and their molecular species composition was determined by combined ... combined HPLC/ MS The results in Table show a typical molecular species composition of the diacylglycerol subclass from untreated hepatocytes; the corresponding HPLC trace is shown in Fig 4A Control ... M199 medium containing 0.2% (w/v) bovine serum albumin D-[U-1 4C] Glucose, [32P]ATP[cP], [9,10-3H]myristic acid, [9,10-3H]palmitic acid and the Renaissance Western blot chemiluminescence reagent...

Ngày tải lên: 20/02/2014, 02:21

12 592 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... millimolar concentration of mitoDC-81 within mitochondria on incubation of cells with high nanomolar to micromolar concentrations of mitoDC-81 This high local concentration of mitoDC-81 within mitochondria ... mitoDC-81 are sufficient to alkylate linear, circular and supercoiled DNA As these concentrations of mitoDC-81 are easily achieved within the mitochondrial matrix on incubation with mitoDC-81 ... Pyrrol[1,4]benzodiazepine antibiotics Proposed structures and characteristics of the in vitro deoxyribonucleic acid adducts of anthramycin, tomaymycin, sibiromycin, neothramycins A and B Biochemistry 20, 1111–1119...

Ngày tải lên: 20/02/2014, 11:20

10 639 0
Tài liệu Báo cáo khoa học: Transactivation properties of c-Myb are critically dependent on two SUMO-1 acceptor sites that are conjugated in a PIASy enhanced manner pptx

Tài liệu Báo cáo khoa học: Transactivation properties of c-Myb are critically dependent on two SUMO-1 acceptor sites that are conjugated in a PIASy enhanced manner pptx

... (Life Technologies) The cDNA was diluted fivefold prior to PCR amplification using primers speci c for chicken mim-1 and chicken GAPDH, respectively Real-time PCR was performed on a LightCycler rapid ... differences are caused by abolished sumoylation, which alters the transactivation properties Such changes could occur directly, by modulation of Myb’s intrinsic activation potential, or indirectly ... PJ69–4a cells transformed with plasmids encoding UBC9 fused to GAL4-AD (pACT2-UBC9), c- Myb fused to GAL4-DBD (pDBT-hcM) and the two corresponding empty vectors in the indicated combinations LacZ reporter...

Ngày tải lên: 21/02/2014, 00:20

11 557 0
C++/CLI Language Specification docx

C++/CLI Language Specification docx

... Instance constructors Unlike Standard C+ +, C+ +/CLI supports static constructors (§8.8.9) As such, this specification refers to constructors as defined by the C+ + Standard as being instance constructors ... keywords, classes, exceptions, namespaces, and library facilities, as well as garbage collection C+ +/CLI Language Specification Conformance Clause §1.4, “Implementation compliance”, of the C+ + Standard ... Object^ a) { … } Object^ a, Object^ b) { … } Object^ a, Object^ b, Object^ c) s, array^ args) { … } The CLI library specification shows library functions using C# syntax, in which case,...

Ngày tải lên: 05/03/2014, 12:20

304 6,9K 0
C++/CLI Language Specification ppt

C++/CLI Language Specification ppt

... Instance constructors Unlike Standard C+ +, C+ +/CLI supports static constructors (§8.8.9) As such, this specification refers to constructors as defined by the C+ + Standard as being instance constructors ... keywords, classes, exceptions, namespaces, and library facilities, as well as garbage collection C+ +/CLI Language Specification Conformance Clause §1.4, “Implementation compliance”, of the C+ + Standard ... Object^ a) { … } Object^ a, Object^ b) { … } Object^ a, Object^ b, Object^ c) s, array^ args) { … } The CLI library specification shows library functions using C# syntax, in which case,...

Ngày tải lên: 06/03/2014, 00:22

304 10,6K 0
Báo cáo khoa học: The ATPase activities of sulfonylurea receptor 2A and sulfonylurea receptor 2B are influenced by the C-terminal 42 amino acids doc

Báo cáo khoa học: The ATPase activities of sulfonylurea receptor 2A and sulfonylurea receptor 2B are influenced by the C-terminal 42 amino acids doc

... Park S, Lim BB, Perez-Terzic C, Mer G & Terzic A (2008) Interaction of asymmetric ABCC9-encoded nucleotide binding domains determines KATP channel SUR2A catalytic activity J Proteome Res 7, 1721–1728 ... this idea, if KATP channels are preblocked with AMP-PCP, then GTP (at concentrations that not interact with Kir6.2) activates SUR2B-containing channels but blocks Kir6.2 ⁄ SUR2A channels [5] It ... SUR2A, which might also reflect longer occupancy of site by MgADP [5] We therefore conclude that the lower ATP hydrolysis rate of SUR2B is associated with longer occupancy of the MgADP-bound activated...

Ngày tải lên: 06/03/2014, 11:20

9 620 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

... 5¢-TTCGA GGCCCGCGCCGCAATTGGGGGCCCAGAA-3¢ and 5¢TTCTGGGCCCCCAATTGCGGCGCGGGCCTCGAA-3¢ for E190A, 5¢-ATTCCGGTTACTTTCGCGGCCCGCGC CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E190A, 5¢-CAAATTGGGGG ... CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E199A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC AAG-3¢ and 5¢-CTTGGCTCCAGACTGTGCAGACTTCC CAGCTTC-3¢ for E204A Mutated codons ... primers 5¢-TCTCGGAGATCC GACAGA-3¢ and 5¢-CTTTCGGGCTTTGTTAGCAG-3¢, respectively CD spectra were acquired on a J-810 spectropolarimeter (Jasco, Tokyo, Japan) with an attached Peltier temperaturecontrolled...

Ngày tải lên: 07/03/2014, 04:20

14 417 0
w