c 915 965 duchess of france countess of paris and duchess of burgundy
C++ Basics - More Flow of Control
Ngày tải lên :
12/09/2012, 22:47
... inner block and cannot be accessed outside the inner block The other variable exists only in the outer block and cannot be accessed in the inner block Copyright © 2007 Pearson Education, Inc Publishing ... the action of a branch is too simple to warrant a function call, use multiple statements between braces A block is a section of code enclosed by braces Variables declared within a block, are ... 37 switch-statement Syntax switch (controlling expression) { case Constant_1: statement_Sequence_1 break; case Constant_2: Statement_Sequence_2 break; case Constant_n: Statement_Sequence_n break;...
- 118
- 440
- 0
Tài liệu Báo cáo khoa học: Association of mammalian sterile twenty kinases, Mst1 and Mst2, with hSalvador via C-terminal coiled-coil domains, leads to its stabilization and phosphorylation doc
Ngày tải lên :
19/02/2014, 06:20
... (1995) Cloning and characterization of a human protein kinase with homology to Ste20 J Biol Chem 270, 21695–21700 Creasy CL & Chernoff J (1995) Cloning and characterization of a member of the ... scaffold protein, connector enhancer of KSR1, CNK1, mediates the pro-apoptotic effects of a constitutively active Ras [15,25] Furthermore, Nore1 appears to direct recruitment of Mst1 to Ras complexes ... the C- terminal coiled-coil domains of Sav and Hpo were also crucial and ⁄ or sufficient for their interaction [19,21,23] These results indicate that the coiled-coil interaction between Mst and...
- 13
- 321
- 0
Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc
Ngày tải lên :
19/02/2014, 13:20
... abundance of heparin-like structures on the surface of the vascular bed, and the lack of good estimates of local concentrations of coagulation proteins or reactants during hemostatic reactions, ... Bottom right: molecular surface of FVa domains A1, A2, and A3 color-coded according to electrostatic potentials Preliminary docking of FVa Arg506 into the catalytic cleft of APC suggests that the ... FXa cofactor activity of the reaction intermediate, FVaint This facilitated the determination of loss of FVa cofactor activity during the initial stage of inactivation and minimized the influence...
- 13
- 654
- 0
Tài liệu C++ Lab 6 Review of Variables, Formatting & Loops docx
Ngày tải lên :
20/02/2014, 08:20
... endl; switch (grade) { case 'A' : cout
- 7
- 393
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
Ngày tải lên :
22/02/2014, 04:20
... enhancing effect of TS on LPS/IFN-induced NO production is caused by enhancement of iNOS protein induction Effects of a-T and its derivatives on the enhancement by TS of LPS/IFN-induced NO production ... N., Mayne, G .C. , Olejnicka, B., Negre-Salvayre, A., Stı´ cha, M., Coffey, R.J & Weber, C (2001) Induction of cancer cell apoptosis by a-tocopheryl succinate: molecular pathways and structural requirements ... (Ro31-8220 and GF109203X) on the enhancement by TS of LPS/IFNinduced NO production in VSMC (A), and Western blot analysis of PKCa in control VSMC, VSMC treated with LPS/IFN and VSMC treated with TS and...
- 6
- 494
- 0
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx
Ngày tải lên :
22/02/2014, 07:20
... domains by chemical modification J Biol Chem 253, 149–159 Rieder, R & Bosshard, H.R (1980) Comparison of the binding sites on cytochrome c for cytochrome c oxidase, cytochrome bc1 and cytochrome c1 J ... Hoganson, C. W., Babcock, G.T & Ferguson-Miller, S (1999) Definition of the interaction domain for cytochrome c on cytochrome c oxidase I Biochemical, spectral, and kinetic characterization of surface ... the docked complex by a complete, systematic search J Biol Chem 274, 38051–38060 Michel, B & Bosshard, H.R (1984) Spectroscopic analysis of the interaction beween cytochrome c and cytochrome c oxidase...
- 9
- 457
- 1
Báo cáo khoa học: Role of the C-terminal extension in a bacterial tyrosinase Michael Fairhead and Linda Thony-Meyer doc
Ngày tải lên :
06/03/2014, 11:20
... (Varian Inc., Zug, Swizerland) Kinetic parameters were calculated using prism (GraphPad Software Inc., San Diego, CA, USA) Bioinformatics The molecular mass and theoretical extinction coefficient of ... importance of this accessory ‘caddie protein’ for copper incorporation into the Streptomyces tyrosinase [7,9] and the expression of active Streptomyces tyrosinase in either Escherichia coli or ... (2006) Crystallographic evidence that the dinuclear copper center of tyrosinase is flexible during catalysis J Biol Chem 281, 8981–8990 Klabunde T, Eicken C, Sacchettini JC & Krebs B (1998) Crystal...
- 13
- 778
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
Ngày tải lên :
07/03/2014, 05:20
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... late-endosome ⁄ vacuole Traf c 2, 622–630 Piper RC, Cooper AA, Yang H & Stevens TH (1995) VPS27 controls vacuolar and endocytic traf c through a prevacuolar compartment in Saccharomyces cerevisiae J Cell ... the conserved RDF sequence for assembly and activity can be overcome by addition of Vta1p and a second Vps4p molecule with an intact C- terminal helix We also find evidence for the co-evolution of...
- 23
- 490
- 0
C++ Lab 15 Review of Arrays, Array of Objects and Vector Dr. John Abraham, Professor doc
Ngày tải lên :
08/03/2014, 00:20
... (shuffled[]) and place random numbers from to 52 in it Once we have the random numbers, we just display the card names in that order string cards[52]={ "CA", "C2 ", "C3 ", "C4 ", "C5 ", "C6 ", "C7 ", "C8 ", "C9 ", "C1 0","CJ","CQ","CK", ... data, the second one to find the difference of each score from the mean and the third one to find store the square of deviation of each score The mean is calculated by adding all valid scores stored ... Read scores from a file into an array Keep track of number of scores entered Find difference of each score from the Mean Square the differences and add the squares find stadard deviation create...
- 7
- 416
- 1
Báo cáo " Cell suspension culture Panax ginseng C. A. Meyer: Role of plant growth regulators and medium composition on biomass and ginsenoside production " docx
Ngày tải lên :
14/03/2014, 10:20
... tissue culture process in order to be economically competitive with field cultivation of ginseng A number of physical and chemical factors that could influence secondary metabolite in plant cell cultures ... of the hormone concentration and combination are often effective For ginseng cell growth, 2,4 D is most commomly used in routine culture maintenance [6] But use of this suspected carcinogen often ... established cell suspension culture of ginseng cell and some attempts have been made to increase biomass and ginsenoside yield of ginseng cell culture Materials and methods Stock cell culture and culture...
- 6
- 492
- 0
Báo cáo khoa học: Hydroperoxide reduction by thioredoxin-specific glutathione peroxidase isoenzymes of Arabidopsis thaliana potx
Ngày tải lên :
16/03/2014, 12:20
... ATGGCTGCAGAAAAAACCG ⁄ GGATCCTTTAAGCG GCAAGCAA), AtGPX2 (CATATGGCGGATGAATC TCCAA ⁄ GGATCCTCCTCCTCCTGGTGAT), AtGPX5 (CATATGGGTGCTTCATCATCAT ⁄ GGATCCCTGTG CGTGTTCACAA) and AtGPX6 (CATATGGCAGC AGAGAAGTCTG ⁄ ... AGAGAAGTCTG ⁄ GGATCCAGTTATCCAGATTGAA) without transit peptides or Trx h2 (CATATGGGA GGAGCTTTATC ⁄ GGATCCGCGTTAACAATGCTCA) and Trx h3 (CATATGGAAGAGAAGCCGCA ⁄ GGATCC AAATCAAGCAGCAGC) proteins were ... Journal compilation ª 2006 FEBS A Iqbal et al several other plants, such as tomato, sunflower and Chinese cabbage, and microorganisms such as Synechocystis PCC 6803, Saccharomyces cerevisiae and Plasmodium...
- 9
- 414
- 0
Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx
Ngày tải lên :
23/03/2014, 04:21
... brucei cytochrome c (pKK223–Tbcytc), its CXXCH variant (pKK223–TbcytcCXXCH), S cerevisiae cytochrome c heme lyase (pACcyc3) and iso-1-cytochrome c (pScyc1) were as previously described [9,33] Cells ... periplasm of E coli by the E coli Ccm apparatus (C) Absorption spectra of concentrated cytoplasmic extracts from E coli coexpressing heme lyase and cytochrome c Wild-type T brucei cytochrome c (black ... ¨ ¨ Structure of Crithidia fasciculata cytochrome c Fig Comparison between the structures of C fasciculata cytochrome c (protein main chain in red) and S cerevisiae iso-1-cytochrome c (Protein...
- 11
- 513
- 0
Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx
Ngày tải lên :
23/03/2014, 09:20
... eukaryotic cytosolic enzymes contain positively charged C- terminal extensions The C- terminal sequence of S cerevisiae and Z mays cytosolic SerRSs is shown in bold letters The sequence truncated ... representation and western blot analysis of full-length and deletion constructs of yeast (S cerevisiae, Sc) and maize cytosolic (Z mays, Zmc) SerRS (A) The names of the constructs used as baits ... specificity of the SerRS–Pex21p interaction, the full-length maize (Zea mays cytosolic, Zmc) SerRS (LexA–ZmcSerRS) and its truncated variant (LexA–ZmcSerRSDC26), lacking 26 C- terminal amino acids,...
- 12
- 406
- 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
Ngày tải lên :
23/03/2014, 11:20
... R GGCAACGAGCAAGGTCCGAAG AAGTCGTTGCAATCGGCGTCG GGCAACGAGCAAGGTCCGAAG GACGTCGTGAGTGCCTCCGTG CGACGTGCAGTATTACTTTTCTAGGG AGTATCAAACCGTGCTGGTCTCC Bioinformatic analyses Sequence similarity searches ... described for CCPs and MauGs In conclusion, we have described a novel C- type heme protein located to the cellular surface of the methanotrophic bacterium M capsulatus This protein shares characteristics ... Detection of C- type heme Because of the sequence similarity of SACCP to members of the BCCP family of proteins and the prediction of heme-binding motifs in the primary sequence, it was of interest...
- 12
- 392
- 0
Báo cáo khoa học: Elements of the C-terminal t peptide of acetylcholinesterase that determine amphiphilicity, homomeric and heteromeric associations, secretion and degradation docx
Ngày tải lên :
23/03/2014, 12:20
... dimerization and reduced the level of secreted tetramers, as discussed above Fig Effects of the C- terminal cysteine (C3 7), of C- terminal segments and of a KDEL motif on acetylcholinesterase (AChE) molecular ... there was no interaction with QN in the case of W17L and W17P, a very small production of T4–QN in the case of W17A, and a significant production of this complex in the case of W17F and W17H For these ... W17P Transfection of COS cells COS cells were transfected by the DEAE-dextran method, as described previously [24], using lg of DNA encoding the AChE catalytic subunit and lg of DNA encoding QN...
- 12
- 309
- 0
Báo cáo khoa học: A hydrophobic segment within the C-terminal domain is essential for both client-binding and dimer formation of the HSP90-family molecular chaperone pptx
Ngày tải lên :
23/03/2014, 20:22
... for Scienti c Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan and from Japan Society for the Promotion of Science (to T K N.) References Borkovich, K.A., ... Domain–domain interactions of HtpG, an Esherichia coli homologue of eukaryotic HSP90 molecular chaperone Eur J Biochem 268, 5258–5269 27 Wearsch, P.A & Nicchitta, C. V (1996) Endoplasmic reticulum chaperone ... aggregation of CS, was measured after incubation with various concentrations of recombinant proteins at 45 C for 80 Values are expressed as percents of the absorbance of CS in the absence of additional...
- 9
- 364
- 0
Báo cáo khoa học: Regulation of the muscle-specific AMP-activated protein kinase a2b2c3 complexes by AMP and implications of the mutations in the c3-subunit for the AMP dependence of the enzyme docx
Ngày tải lên :
30/03/2014, 08:20
... ¨ 16 ⁄ 60 column (GE Healthcare) connected to Akta FPLC (GE Healthcare) Expression and purification of recombinant AMPK a2b 2c3 in COS7 cells COS7 cells were cotransfected with cDNAs encoding mouse ... measured the activity of the recombinant AMPK a2b 2c3 complexes over a range of AMP concentrations, and calculated the concentration of AMP giving half-maximal stimulation (A0.5) The bacterially expressed ... However, in vivo activity measurements are complicated by the potential inhibitory effects of glycogen overload, which characterizes skeletal muscle of mice and pigs carrying the c3 R225Q substitution,...
- 10
- 553
- 0
Báo cáo khóa học: The C-terminal t peptide of acetylcholinesterase forms an a helix that supports homomeric and heteromeric interactions potx
Ngày tải lên :
30/03/2014, 13:20
... interactions occurring in the concentration range of the critical micellar concentration (cmc) [17] For lysolecithin, the cmc is 20 lM, corresponding to Ri values of 5–6 and 30–40, for peptide concentrations ... Prediction of secondary structure elements The secondary structure of the C- terminal region of the catalytic domain and of the t peptide was predicted according to Rost [27] using PREDICTPROTEIN ... LE80K centrifuge using an SW-41 rotor (Beckman–Coulter, Villepinte, France) Fractions of 300 lL were collected and assayed for AChE, b-galactosidase and alkaline phosphatase activities Electrophoresis...
- 15
- 333
- 0
Báo cáo khóa học: NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene ppt
Ngày tải lên :
30/03/2014, 13:20
... 5¢-primers, CMV IE ()740) 5¢-AGGT ACCCAATATTGGCCATTAGCC-3¢; CMV IE ()507) 5¢-CGGTACCTGGCCCGCCTGGCTGAC-3¢; CMV IE ()300) 5¢-TGGTACCATGCCCAGTACATGACCTTA-3¢; CMV IE ()185) 5¢-TGGTACCCGGTTTGACTCACG GGGATT-3¢; ... 1826(S-1, TCCATGAGCTTCCTGACGTT); 1826(S-2, TCCATGACGTTCCTGAGCTT) and 1826(S-3, TCC ATGAGCTTCCTGAGCTT) The non-CpG-ODN 2041 (CTGGTCTTTCTGGTTTTTTTCTGG) served as a negative control The LPS content of ODNs ... TAatcGAtTTTCCTACT-3¢; mNF-jB3, 5¢-GTTTGACT CAatcGatTTTCCAAGTC-3¢; mNF-jB4, 5¢-CCAAAAT CAAatcGatTTTCCAAAATG-3¢; mAP-1, 5¢-TAGCGG TTTatCgatCGGGGATTTCC-3¢ Mutated sites are indicated with lower case letters...
- 12
- 330
- 0
United States General Accounting Office Washington, D.C. 20548 Comptroller General of the United States _part1 docx
Ngày tải lên :
19/06/2014, 13:20
... Abbreviations DACS FDIC FFB FSLIC FIRRELA GCR RTC SAIF Page Division of Accountingand CorporateServices FederalDepositInsuranceCorporation FederalFinancingBank FederalSavingsand Loan InsuranceCorporation ... Treasury; the Chairman of the Board of Governors of the Federal Reserve System; the Acting Comptroller of the Currency; and the Chairmen and Ranking Minority Members of the Senate Committee on ... manner We conducted our audits in accordance with generally accepted government auditing standards Our reports on the Fund’ internal control s structure and its compliance with laws and regulations...
- 11
- 272
- 0