c 910 969 queen and regent of france

Báo cáo y học: "c-Fms-mediated differentiation and priming of monocyte lineage cells play a central role in autoimmune arthritis" docx

Ngày tải lên : 12/08/2014, 11:23

... M-CSF alone displayed a characteristic macrophage phenotype, including extension of multipolar processes and presence of heterogeneous cytoplasmic vacuoles and inclusion bodies (Figure 3b) In contrast, ... Nat Clin Pract Rheumatol 2009, 5:1 Campbell IK, Rich MJ, Bischof RJ, Hamilton JA: The colony-stimulating factors and collagen-induced arthritis: exacerbation of disease by M-CSF and G-CSF and ... role of c- Fms, demonstrating that c- Fms signaling promotes the formation and activation of macrophages and osteoclasts These findings reveal the relevance of c- Fms to specific cellular processes...

15
411
0

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Ngày tải lên : 14/02/2014, 19:20

... Japanese Ministry of Education, Culture, Sports, Science and Technology; the Japan Society for the Promotion of Science; and the Japan Science and Technology Agency References 13 14 15 Pawson ... ﬂuorescence and immunocytochemical staining with anti-Flag or anti-HA sera Cell images were acquired by confocal microscopy (LSM510; Carl Zeiss, Inc., Oberkochen, Germany) Morphometric analysis of ... T, Courtney MJ & Coffey ET (2005) Constitutively active cytoplasmic c- Jun N-terminal kinase is a dominant regulator of dendritic architecture: role of microtubule-associated protein as an effector...

11
658
0

Tài liệu ICE-CAVES OF FRANCE AND SWITZERLAND pptx

Ngày tải lên : 15/02/2014, 10:20

... move At the bottom of the fan, the flooring of the cave consisted of broken stones for a small space, and then came a black lake of ice, which occupied all the centre of the cave, and afforded us ... 97 CHAPTER VIII THE GLACIẩRE AND NEIGIẩRE OF ARC-SOUS-CICON CHAPTER IX 118 THE SCHAFLOCH, OR TROU-AUX-MOUTONS, NEAR THE LAKE OF THUN 131 CHAPTER X THE GLACIẩRE OF GRAND ANU, NEAR ANNECY 157 CHAPTER ... GLACIẩRE OF THE PRẫ DE S LIVRES 41 SECOND CAVE OF THE UPPER GLACIẩRE OF THE PRẫ DE S LIVRES 50 VERTICAL SECTIONS OF THE UPPER GLACIẩRE OF THE PRẫ DE S LIVRES VERTICAL SECTION OF THE GLACIẩRE OF...

260
394
0

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

Ngày tải lên : 16/02/2014, 09:20

... activation of a family of cytosolic cysteine proteases, caspases, which are required for many of the morphological changes that occur during apoptosis The mitochondrial release of cytochrome c ... membranes, which liberates cytochrome c and activates caspase and the apoptosome [23] Transfection of tBid directly triggers mitochondrial-dependent apoptosis and caspase activation [17] Because Itch overexpression ... ﬁnal concentration of 1% Extracts were incubated for 20 at C and centrifuged at 18 000 g in a microcentrifuge at C For immunoprecipitation assays, extracts of transfected cells were immunprecipitated...

12
718
0

Tài liệu Finance and Economics Discussion Series Divisions of Research & Statistics and Monetary Aﬀairs Federal Reserve Board, Washington, D.C.: Interest Rate Risk and Bank Equity Valuations doc

Ngày tải lên : 17/02/2014, 03:20

... such an approach, we include a number of macroeconomic and financial indicators—denoted by the vector mt —in the regression in order to control for the cyclical changes in macroeconomic conditions ... bank-speci c characteristics, denoted by the vector Xit The specification also includes a bank-speci c fixed effect ηi , which controls for the fact that the average level of bank-speci c variables ... reaction of bank stock returns to policy-induced interest rate shocks varies across banks, according to key banks characteristics that a priori can be expected to influence that reaction We construct...

47
528
1

Tài liệu Báo cáo khoa học: Efﬁcient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

Ngày tải lên : 18/02/2014, 08:20

... triplicate Subcellular location of STAT1 determined by fluorescence microscopy: (B) cytoplasmic location of STAT1 in untreated cells and nuclear location in IFN -c treated cells (20 ngÆmL)1); (C) cytoplasmic ... STAT3-speci c or could also interact with STAT1 and disrupt its signalling In colorectal carcinoma cells, treatment with IFN -c sensitizes cells to cytotoxic compounds, and can also induce cell death ... cell death of the colon carcinoma SW480 cells To examine the transfection efficiency of hpST3dODN into cells, we applied different concentrations of the fluorescein isothiocyanate (FITC)-labelled...

11
558
0

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the ﬁlamentous fungus Trichoderma reesei ppt

Ngày tải lên : 19/02/2014, 06:20

... TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT GGT GGT GGT GGT GCA GAG GAG GGA TAT GGG GAA CGG CAA A The PCR reaction ... add EcoRI and KpnI restriction endonuclease sites to the 5¢ and 3¢ ends, respectively The primers used were as follows: forward primer, GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT ... CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C The PCR reaction was done as described above The ampliﬁed PCR product was inserted into the EcoRI and KpnI sites of...

14
650
0

Tài liệu Báo cáo khóa học: Non-speciﬁc depolymerization of chitosan by pronase and characterization of the resultant products pptx

Ngày tải lên : 19/02/2014, 12:20

... CP-MAS 1 3C- NMR chemical shift values of ring and methyl carbons of native chitosan, LMWC and chito-oligomers Chemical shift values (p.p.m.) Sample CH3 C2 /C6 C3 /C5 C4 C1 -C O Chitosan LMWC (1 h) Chito-oligomers ... standards Circular Dichroism (CD) CD spectra for native chitosan and LMWC (5 mgÆmL)1 in 0.1 M perchloric acid; path length, cm) were recorded on a Jasco J-810 automatic recording spectropolarimeter, continuously ... sequence in chitosan is of four types, -GlcN-GlcN-, -GlcN-GlcNAc-, -GlcNAc-GlcNand -GlcNAc-GlcNAc-, of which the ﬁrst is the major type and the last one results from the heterogeneous de-Nacetylation...

11
673
0

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Ngày tải lên : 20/02/2014, 01:20

... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...

15
597
0

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Ngày tải lên : 20/02/2014, 11:20

... Pyrrol[1,4]benzodiazepine antibiotics Proposed structures and characteristics of the in vitro deoxyribonucleic acid adducts of anthramycin, tomaymycin, sibiromycin, neothramycins A and B Biochemistry 20, 1111–1119 ... DNA and high micromolar concentrations of mitoDC-81 are sufﬁcient to alkylate linear, circular and supercoiled DNA As these concentrations of mitoDC-81 are easily achieved within the mitochondrial ... mitochondria or cells The reasons for the lack of alkylation of mtDNA within mitochondria by mitoDC-81 are unclear The local concentrations of mitoDC-81 and DNA, and the duration of the experiments...

10
638
0

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

Ngày tải lên : 21/02/2014, 00:20

... NapC_Rsph CymA_Sput NrfH_Ddes NrfH_Sdel NrfH_Wsuc Cytc_Dgig Cytc_Ddes 110 L ECRNCHNF E L ECRNCHSAE L ECRNCHAAV L ECRNCHSEV ANCQHCHT RI ANCKACHT QT CI S CHQS L CI SCHASL CHNI L CHANT ... sequencing, the oligonucleotide ccNiR_GTPRNGPW, 5¢-GGIACICCIMGIAAYG GICCITGG-3¢, was synthesized and used together with the primer ccNiR_Cterm, 5¢-TCYTGICCYTCCCASACYT GYTC-3¢, already used in nrfA ... Structural and functional approach toward a classiﬁcation of the complex cytochrome c system found in sulfate-reducing bacteria Biochim Biophys Acta 1058, 61–66 Ó FEBS 2003 Characterization of ccNiR...

12
593
0

Tài liệu Báo cáo khoa học: Puriﬁcation and characterization of a sialic acid speciﬁc lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Ngày tải lên : 21/02/2014, 00:20

... affinity of the humoral agglutinin BSM contains the sialic acids, N-acetylneuraminic acid, N-glycolylneuraminic acid, N-acetyl 9-O-acetylneuraminic acid and, 8,9-di-O-acetylneuraminic acid [6] and ... EDTA, and mL fractions collected on ice in polypropylene tubes containing 100 lL of 100 mM CaCl2 at a rate of 0.3 mLÆmin)1 The presence of calcium chloride was required in the collected fractions ... was helpful in deducing the binding specificity of the lectin Fucose and lactose inhibited HA activity of purified lectin Sucrose, glucose and glucose-6-phosphate inhibit at concentrations less than...

8
616
0

Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt

Ngày tải lên : 21/02/2014, 01:21

... sample Speci c primers directed against human sequences for c- myc and GAPDH and PCR conditions were as previously described [20] Analysis of c- myc gene transcription by nuclear runoff assay To ... obtained using lL of the RT products after 30 cycles of PCR ampliﬁcation The lower part of panel A, and panels B, C report the expression of c- myc mRNA levels detected by[32P]dCTP-PCR Individual ... each primer pairs by using 0.5 lCi of [a-32P]dCTP (speci c activity 3000 CiÆmmol)1, Amersham Pharmacia Biotech) and establishing the point at which exponential accumulation plateaus Using 30 PCR...

10
703
0

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Ngày tải lên : 06/03/2014, 01:20

... chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Although the incidence of acute HBV infection is declining ... cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the ... leading causes of this type of cancer Key characteristics of hepatitis B and hepatitis C are summarized in Table 1-1 and discussed below and in later chapters PREPUBLICATION COPY: UNCORRECTED PROOF...

191
457
0

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Ngày tải lên : 06/03/2014, 01:20

... prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Although the incidence of acute HBV infection ... B and chronic hepatitis C are serious and can result in liver cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C ... immunization, and catchup vaccination of unvaccinated children and adolescents—has resulted in a dramatic reduction in chronic HBV infection in infants and acute HBV infection in children of all ethnicities...

253
369
0

CATHEDRALS AND CLOISTERS OF THE SOUTH OF FRANCE ppt

Ngày tải lên : 06/03/2014, 03:21

... telling of the Cathedrals of the South which was at once accurate and complete For the Cathedrals of that country are monuments not only of architecture and its history, but of the history of peoples, ... one, and the splendour and brilliance of the other A GOTHIC AISLE. MENDE [To List] Provence Top The three provinces which compose the South of France are Provence, Languedoc, and Gascony, and of ... architectural style It is a country of few Cathedrals, of curious churches built for war and prayer, and of such occasional outbursts of magnificence as is seen in the Romanesque portal of Saint-Pierre...

194
311
0

Báo cáo khoa học: Comparing the substrate speciﬁcities of cytochrome c biogenesis Systems I and II docx

Ngày tải lên : 06/03/2014, 09:22

... which in some organisms is two separate proteins CcmH and CcmI [50], appears to be involved in both heme handling ⁄ ligation and reductant provision [2] CcmH CcmE p-side CcmB CcmC D CcmG CcmF ... absence of a gene for an exogenous cytochrome System II can mature monoheme c- type cytochromes in E coli Cytochrome c5 50 from Paracoccus denitriﬁcans is well characterized as a heterologous holocytochrome ... spectra of periplasmic extracts from E coli EC06 cells expressing H pylori ResBC and P denitriﬁcans cytochrome c5 50 (broken-dotted line), cytochrome c5 50 AXXAH variant (full line) and no cytochrome...

12
469
0

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

Ngày tải lên : 06/03/2014, 11:20

... chain factors, eukaryotic class polypeptide chain release factor (eRF1) and eukaryotic class polypeptide chain release factor (eRF3) The major functions of eRF1 include recognition of each of the ... structure and function of the eRF1 C- domain A B C E D Fig The solution structure of the C- domain (A) Stereo view of the ensemble of the ﬁnal 48 calculated structures Twenty-four structures of ... were incubated at 37 C with 2.5 pmol of eRF1 for 0–15 Ribosomes and tRNA were pelleted with ice-cold 5% trichloroacetic acid, supplemented with 0.75% casamino acids, and centrifuged at C and 14...

17
490
0

Báo cáo khoa học: C-terminal, endoplasmic reticulum-lumenal domain of prosurfactant protein C – structural features and membrane interactions ppt

Ngày tải lên : 07/03/2014, 05:20

... micromolar range (Fig 6B) Effect of phospholipid vesicles on CTC thermal unfolding Effect of phospholipid vesicles on CTC secondary structure Discussion The CD spectrum of CTC in the absence of ... Fluorescence emission spectra of CTC in the absence (black line) and presence of increasing concentrations of bis-ANS (B) The efficiency of energy transfer from Tyr to bis-ANS (C) Data from the spectra ... maxima at 59 C and 66–67 C (Fig 8B) The first, second and third heat capacity curves of membrane-bound CTC overlapped Intrinsic fluorescence experiments The intrinsic Tyr fluorescence of CTC was measured...

12
310
0

Báo cáo khoa học: Hierarchical subfunctionalization of fabp1a, fabp1b and fabp10 tissue-speciﬁc expression may account for retention of these duplicated genes in the zebraﬁsh (Danio rerio) genome docx

Ngày tải lên : 07/03/2014, 12:20

... contig ctg30243.1 assembly Zv2 and antisense 5¢-AATCCCCTT GACAAACGCTG-3¢; nucleotides 99 693–99 712, contig ctg30243.1 assembly Zv2), fabp1b cDNA (sense 5¢-ACCA CAGTCTAATGCCTTCC-3¢; nucleotides ... 5¢-GTGTGTTTGCTCAGCTCATG-3¢; nucleotides 462–443, Fig 1B and inner: 5¢-GATTCTGTTCAGCACCACCT-3¢; nucleotides 343–324, Fig 1B), or to zebrafish fabp10 cDNA (outer: 5¢-TGGTGGTGATTTCAGCCTC-3¢; nucleotides ... zebrafish fabp1a cDNA (outer: 5¢-CGTCTGCTGATCCT CTTGTAG-3¢; nucleotides 431–411, Fig 1A and inner: 3226 5¢-CGACCTCATCATCCGGCAC-3¢; nucleotides 145–127, Fig 1A), to the zebrafish fabp1b cDNA (outer:...

14
554
0