... TTGGCCATATGCAGAAGATCACCGAAGCA ATTCCGGAC ACGGATCCA ATTAATCTC …20 EAMKLVAAAK-31 TCCGGCATATGGAAGCAATGAAGCTCGTC …60 TE-62 TCGCGCATATGACTGAGGATGTTGATGTT (Fig 2A) Each of the c constructs reacted with c antiserum ... following primers: 5¢-GACGGATCC CCATGACCTTAAATCTTTGT-3¢ as the 5¢ primer and 5¢-ATAGTCGACCTGGTTACGAAGAAATCG-3¢ as the 3¢ primer The PCR products were cleaved with BamHI and EcoRI, and cloned into plasmid ... deletion of 60 residues (cDN60) Plasmid Amino-acid sequences pET11-cWT pET11-cDN8 ANLRELRDRIGSVKNTQKITEAMKLVAAAK-31 TTTGTCATATGGCAAACCTCCGTGAGC …8RIGSVKNTQKITEAMKLVAAAK-31 GGCCATATGCGGATCGGATCAGTCAAA...
Ngày tải lên: 23/03/2014, 13:20
... Japanese Ministry of Education, Culture, Sports, Science and Technology; the Japan Society for the Promotion of Science; and the Japan Science and Technology Agency References 13 14 15 Pawson ... fluorescence and immunocytochemical staining with anti-Flag or anti-HA sera Cell images were acquired by confocal microscopy (LSM510; Carl Zeiss, Inc., Oberkochen, Germany) Morphometric analysis of ... T, Courtney MJ & Coffey ET (2005) Constitutively active cytoplasmic c- Jun N-terminal kinase is a dominant regulator of dendritic architecture: role of microtubule-associated protein as an effector...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt
... activation of a family of cytosolic cysteine proteases, caspases, which are required for many of the morphological changes that occur during apoptosis The mitochondrial release of cytochrome c ... membranes, which liberates cytochrome c and activates caspase and the apoptosome [23] Transfection of tBid directly triggers mitochondrial-dependent apoptosis and caspase activation [17] Because Itch overexpression ... final concentration of 1% Extracts were incubated for 20 at C and centrifuged at 18 000 g in a microcentrifuge at C For immunoprecipitation assays, extracts of transfected cells were immunprecipitated...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
... triplicate Subcellular location of STAT1 determined by fluorescence microscopy: (B) cytoplasmic location of STAT1 in untreated cells and nuclear location in IFN -c treated cells (20 ngÆmL)1); (C) cytoplasmic ... STAT3-speci c or could also interact with STAT1 and disrupt its signalling In colorectal carcinoma cells, treatment with IFN -c sensitizes cells to cytotoxic compounds, and can also induce cell death ... cell death of the colon carcinoma SW480 cells To examine the transfection efficiency of hpST3dODN into cells, we applied different concentrations of the fluorescein isothiocyanate (FITC)-labelled...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf
... thrombin-induced Ca2+ integral with an IC50 of approximately 10 nm and lm, respectively, which is in accordance with the known affinity of these compounds for the PI3-K catalytic subunits At these concentrations ... ADPinduced platelet aggregation Proc Natl Acad Sci USA 95, 8070–8074 ´ Gachet C, Hechler B, Leon C, Vial C, Leray C, Ohlmann P & Cazenave JP (1997) Activation of ADP receptors and platelet function ... thrombin is induced in situ by activation of PRP with tissue factor and CaCl2, the P2Y12 ⁄ PI3-K pathway significantly enhances the activation state and, hence, the procoagulant activity of platelets...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT GGT GGT GGT GGT GCA GAG GAG GGA TAT GGG GAA CGG CAA A The PCR reaction ... add EcoRI and KpnI restriction endonuclease sites to the 5¢ and 3¢ ends, respectively The primers used were as follows: forward primer, GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT ... CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C The PCR reaction was done as described above The amplified PCR product was inserted into the EcoRI and KpnI sites of...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx
... CP-MAS 1 3C- NMR chemical shift values of ring and methyl carbons of native chitosan, LMWC and chito-oligomers Chemical shift values (p.p.m.) Sample CH3 C2 /C6 C3 /C5 C4 C1 -C O Chitosan LMWC (1 h) Chito-oligomers ... standards Circular Dichroism (CD) CD spectra for native chitosan and LMWC (5 mgÆmL)1 in 0.1 M perchloric acid; path length, cm) were recorded on a Jasco J-810 automatic recording spectropolarimeter, continuously ... sequence in chitosan is of four types, -GlcN-GlcN-, -GlcN-GlcNAc-, -GlcNAc-GlcNand -GlcNAc-GlcNAc-, of which the first is the major type and the last one results from the heterogeneous de-Nacetylation...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx
... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc
... Pyrrol[1,4]benzodiazepine antibiotics Proposed structures and characteristics of the in vitro deoxyribonucleic acid adducts of anthramycin, tomaymycin, sibiromycin, neothramycins A and B Biochemistry 20, 1111–1119 ... DNA and high micromolar concentrations of mitoDC-81 are sufficient to alkylate linear, circular and supercoiled DNA As these concentrations of mitoDC-81 are easily achieved within the mitochondrial ... mitochondria or cells The reasons for the lack of alkylation of mtDNA within mitochondria by mitoDC-81 are unclear The local concentrations of mitoDC-81 and DNA, and the duration of the experiments...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... NapC_Rsph CymA_Sput NrfH_Ddes NrfH_Sdel NrfH_Wsuc Cytc_Dgig Cytc_Ddes 110 L ECRNCHNF E L ECRNCHSAE L ECRNCHAAV L ECRNCHSEV ANCQHCHT RI ANCKACHT QT CI S CHQS L CI SCHASL CHNI L CHANT ... sequencing, the oligonucleotide ccNiR_GTPRNGPW, 5¢-GGIACICCIMGIAAYG GICCITGG-3¢, was synthesized and used together with the primer ccNiR_Cterm, 5¢-TCYTGICCYTCCCASACYT GYTC-3¢, already used in nrfA ... Structural and functional approach toward a classification of the complex cytochrome c system found in sulfate-reducing bacteria Biochim Biophys Acta 1058, 61–66 Ó FEBS 2003 Characterization of ccNiR...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... affinity of the humoral agglutinin BSM contains the sialic acids, N-acetylneuraminic acid, N-glycolylneuraminic acid, N-acetyl 9-O-acetylneuraminic acid and, 8,9-di-O-acetylneuraminic acid [6] and ... EDTA, and mL fractions collected on ice in polypropylene tubes containing 100 lL of 100 mM CaCl2 at a rate of 0.3 mLÆmin)1 The presence of calcium chloride was required in the collected fractions ... was helpful in deducing the binding specificity of the lectin Fucose and lactose inhibited HA activity of purified lectin Sucrose, glucose and glucose-6-phosphate inhibit at concentrations less than...
Ngày tải lên: 21/02/2014, 00:20
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt
... chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Although the incidence of acute HBV infection is declining ... cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the ... leading causes of this type of cancer Key characteristics of hepatitis B and hepatitis C are summarized in Table 1-1 and discussed below and in later chapters PREPUBLICATION COPY: UNCORRECTED PROOF...
Ngày tải lên: 06/03/2014, 01:20
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc
... prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Although the incidence of acute HBV infection ... B and chronic hepatitis C are serious and can result in liver cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C ... immunization, and catchup vaccination of unvaccinated children and adolescents—has resulted in a dramatic reduction in chronic HBV infection in infants and acute HBV infection in children of all ethnicities...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf
... chain factors, eukaryotic class polypeptide chain release factor (eRF1) and eukaryotic class polypeptide chain release factor (eRF3) The major functions of eRF1 include recognition of each of the ... structure and function of the eRF1 C- domain A B C E D Fig The solution structure of the C- domain (A) Stereo view of the ensemble of the final 48 calculated structures Twenty-four structures of ... were incubated at 37 C with 2.5 pmol of eRF1 for 0–15 Ribosomes and tRNA were pelleted with ice-cold 5% trichloroacetic acid, supplemented with 0.75% casamino acids, and centrifuged at C and 14...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx
... the transactivation of growth hormone receptors and in the activation of MAPK cascades, as well as different localizations of the receptor constructs before and after activation may also contribute ... Faussner et al Role of helix and C- termini in bradykinin receptors Fig Schematic representation of the C- terminal B1wt and B2wt sequences and chimera thereof The C- terminal sequences beginning at ... intact cells Biol Chem 385, 835–843 21 Marchese A, Chen C, Kim YM & Benovic JL (2003) The ins and outs of G protein-coupled receptor trafficking Trends Biochem Sci 28, 369–376 22 Kalatskaya I, Schussler...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: "Joint Identification and Segmentation of Domain-Specific Dialogue Acts for Conversational Dialogue Systems" doc
... Tj,i and pick the best returned class (dialogue act label) Cj,i (and associated score, which in the case of our maximum entropy classifier is the conditional probability Score(Cj,i ) = P (Cj,i ... American Chapter of the Association for Computational Linguistics - Human Language Technologies (NAACL HLT) 2009 conference Andreas Stolcke and Elizabeth Shriberg 1996 Automatic linguistic segmentation ... those for the utterances annotated with multiple dialogue acts Each dialogue act class typically contains several more speci c dialogue acts that include domain-speci c semantics (for example, there...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot
... Aspka Bacsp Crcsp Stral Strgr Strli21 Strli24 Strve Thscu Psesa Psest Psesp Bacst Actsp Bac11 Bac17 Bac38 Bac663 Bac1011 BacA2 Bac1018 BacE1 BacKC Bacbr Bacci8 Bacci251 BacciA Baccl Bacli BacmaIB7 ... Bacillus sp KC201 Bacillus brevis Bacillus circulans Bacillus circulans 251 Bacillus circulans A11 Bacillus clarkii Bacillus licheniformis Bacillus macerans IB7 Bacillus macerans IFO 3490 Bacillus ... Klebsiella pneumoniae Nostoc sp PCC 9229 Bacillus circulans strain 251 CGT Klebsiella pneumoniae CGT Nostoc sp PCC 9229 CGT Thermococcus sp B1001 CGT Actinoplanes sp SE50 ACT Bacillus stearothermophilus...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc
... primer (5¢-TCAGGAGCTAA GGAAGCTAAAATGGTGAGCAAGGGCGAG-3¢) and primer (5¢-CCGCTCGAGTTACTTGTACAGCTCGT CCATGCC-3¢) The splice-overlap PCR-product was cloned into pUC18 (NEB) and subsequently cloned into ... (5¢-CCCAAGCTTGGGTGCCCCGCGC AGGGTCGCG-3¢) and primer (5¢-GTACTGTTTCTT CTTCAGCATCACC-3¢) The GAL4-VP16 DNA fragment (678 bp) was produced by PCR from pGAL4-VP16 [26] (a gift from G E O Muscat, ... pSP72 The hygromycin resistance gene was amplified from the pCEP4 plasmid (Invitrogen) with primer (5¢-GGACCAGACCCCACGCAACG-3¢) and primer 10 (5¢-GCCCTGCTTCATCCCCGTGG-3¢) and cloned into the pSP72/5GAL-E1bEGFP...
Ngày tải lên: 08/03/2014, 08:20
Diagnosis, Management, and Treatment of Hepatitis C: An Update docx
... Interpretation Acute or chronic HCV depending on the clinical context Resolution of HCV; Acute HCV during period of low-level viremia Early acute HCV infection; chronic HCV in setting of immunosuppressed ... more of the clinical complications of chronic liver disease — ascites, encephalopathy, variceal bleeding, and/ or impaired hepatic synthetic function — is more problematic Their treatment of choice ... platelet count 75,000 mm and no evidence of hepatic decompensation (hepatic encephalopathy or ascites), and ● Acceptable hematological and biochemical indices (Hemoglobin 13 g/dL for men and 12...
Ngày tải lên: 08/03/2014, 14:20
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx
... used biochemical analysis, fluorescence confocal microscopy and electron microscopy to identify the HD-caveolae as speci c sites of fatty acid uptake and conversion to triacylglycerol, including ... identification [5] of two morphologically distinct classes of caveolae at the plasma membrane ) canonical caveolae that are open to the extracellular space and caveolae lacking access from the cell ... gradient centrifugation of a carbonate extract of rat adipocyte plasma membranes [20] VHD-caveolae lack cell surface access The biotin labelling of cell surface proteins indicates that the VHD-caveolae...
Ngày tải lên: 16/03/2014, 13:20