c 2005 business objects second edition

how to do everything with microsoft office powerpoint 2003 (2003)

how to do everything with microsoft office powerpoint 2003 (2003)

... (without clicking it) Right-click Microsoft PowerPoint, and choose Copy Right-click on the desktop and choose Paste Double-click the shortcut to open PowerPoint Of course, if you don’t like shortcuts, ... can then go directly to the chapters that contain the topics you need How to Contact the Author Please contact me if you don’t understand the material in the book or find any errors You can contact ... However, because of the possibility of human or mechanical error by our sources, McGraw-Hill/Osborne, or others, McGraw-Hill/Osborne does not guarantee the accuracy, adequacy, or completeness...

Ngày tải lên: 26/10/2014, 20:26

434 772 0
Slide tiếng anh 9 Unit 1 A visit from a pen pal _Văn Tiềm

Slide tiếng anh 9 Unit 1 A visit from a pen pal _Văn Tiềm

... to school A) live B) left C) had lived D) lived Correct Click anywhere to Correct Click anywhere to continue continue Incorrect Click anywhere to Incorrect Click anywhere to continue continue ... have a computer => I wish I a computer A) having B) has C) had D) have Correct Click anywhere to Correct Click anywhere to continue continue Incorrect Click anywhere to Incorrect Click anywhere ... hometown A) are B) were C) was D) bed Correct Click anywhere to Correct Click anywhere to continue continue Incorrect Click anywhere to Incorrect Click anywhere to continue continue You must answer...

Ngày tải lên: 09/07/2015, 13:45

21 455 0
How to setup a Linux system that can boot directly from a software RAID

How to setup a Linux system that can boot directly from a software RAID

... Sep 24 18:43:13 2005 clean 2 0 1473528a - correct 0.1994 Major Minor RaidDevice State active sync 0 active sync 1 22 1 active sync [root@fedora4 ~]# mdadm examine /dev/hdc1 /dev/hdc1: /dev/hda1 ... RaidDevice State active sync active sync active sync /dev/hdc1 /dev/hda1 /dev/hdc1 To be able to boot from the second disk if the first fails, GRUB has to be installed on both disks This cab be ... Creation Time : Sat Sep 24 19:52:04 2005 Raid Level : raid1 Raid Devices : Total Devices : Preferred Minor : Update Time State Active Devices Working Devices Failed Devices Spare Devices Checksum...

Ngày tải lên: 18/09/2012, 10:11

14 568 1
John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB.pdf

John.Wiley.And.Sons.Marketing.Insights.From.A.To.Z.eBook-LiB.pdf

... a Coke should mean an eight-ounce soft drink in the famous Coke bottle But ask today for a Coke and you will have to answer whether you want Coca-Cola Classic, Caffeine Free CocaCola Classic, ... soups can cannibalize the sales of the core soups without bringing in much additional revenue to cover the additional costs They can reduce operational efficiency, increase distribution costs, confuse ... Ad mock-ups can be tested for communication effectiveness using recall, recognition, or persuasion measures Postmeasurements strive to calculate the communication or sales impact of the ad campaign...

Ngày tải lên: 21/09/2012, 17:33

226 1,4K 7
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials

Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials

... Medical, known as clinical waste, normally refers to waste product that cannot be considered as general waste, produced from healthcare premises, such as hospital, clinics, doctors’ offices, labs and ... inflammable, etc 1.2 Classification of medical wastes 1.2.2 Infectious waste Infectious wastes can cause harm to people or the environment, and this category includes items such as bandages, surgical gloves, ... Surgical wastes 1.2.1 Hazardous chemical wastes  Expired medicine, low quality medicine  Harmful chemical factor in healthcare  Wastes harm cell  Wastes contain heavy metal 1.2.2 Radioactive...

Ngày tải lên: 23/09/2012, 15:38

10 723 0
 Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

... SA, Tai CT, Chiang CE, Wen ZC, Cheng JJ, Ding YA, Chang MS Comparisons of quality of life and cardiac performance after complete atrioventricular junction ablation and atrioventricular junction ... syncope or other life-threatening complications like ventricular tachycardia and/or ventricular fibrillation may occur Due to the paroxysmal character of the tachycardia, with sudden unexpected ... Coll Anthropol 2003; 27:83-91 Gaita F, Montefusco A, Riccardi R, Scaglione M, Grossi S, Caponi D, Caruzzo E, Guistetto C, Bocchiardo M, Di Donna P Acute and long-term outcome of transvenous cryothermal...

Ngày tải lên: 03/11/2012, 11:44

9 679 0
A visit from a pen pal

A visit from a pen pal

... (Lý vi c quảng c o để bán nhiều hàng hơn.) compulsory (adj): bắt bu c; c ỡng Ex: Is English a compulsory subject? (Tiếng Anh c phải môn h c bắt bu c không?) -> compulsion (n): ép bu c; c ỡng ... held): tổ ch c Ex: The presidential election was held on April 26 (Cu c bầu c tổng thống tổ ch c vào ngày 26 tháng 4.) farewell party (n): ti c/ liên hoan chia tay to wish (v): ư c; mong ư c Ex: ... separated from the factory by a tall fence (Sân nhà họ ngăn c ch với nhà máy hàng rào cao.) -» separate (adj): riêng biệt; kh c —» separation (n): chia tách; ngăn c ch to comprise (v): bao gồm;...

Ngày tải lên: 17/01/2013, 09:58

5 1,7K 0
English Proverbs from A to Z

English Proverbs from A to Z

... likely to occur again in exactly the same circumstances Like father, like son A son's character can be expected to resemble his father's Look before you leap Consider possible consequences before ... bark if you can't bite Don't complain if you can't enforce your point of view Don't count your chickens before they're hatched You must not be too confident that something will be successful Don't ... care for his own family Children and fools tell the truth Clear moon, frost soon If the atmosphere is clear, frost may form Clothes don't make the man Appearances can be deceiving Constant occupation...

Ngày tải lên: 18/06/2013, 01:26

5 624 1
Unit 1: A visit from a pen pal

Unit 1: A visit from a pen pal

... b) I wish I had a computer now c) I wish I lived close to school d) I wish I drew well + Let students make three wishes of their own Practice Individual Homework - Do exercises / P 12 - Learn ... Date of teaching: September 20th, 2006 Period: 06 Activity were a teacher ) b You live in a bike ( I wish I lived in a car ) Form : I wish + S + Past subjunctive + Ask students to ... wishes of their own Practice Individual Homework - Do exercises / P 12 - Learn by heart the structures Remarks ...

Ngày tải lên: 21/06/2013, 01:27

2 1,1K 0
Unit 1: A visit from a pen pal

Unit 1: A visit from a pen pal

... sentences + Call some students practice before the class + Give the correct answers : • 1/ C • 2/ B • 3/D • 4/B + Ask students to recommend places of interest in the city they’ve visited * Cues ... Date of teaching : September 13th , 2007 Period : Production: Presentation: Practice: Homework : their prediction and add some more information + Ask them to choose the correct option to complete ... had a computer now c) I wish I lived close to school d) I wish I drew well + Let students make three wishes of their own - Lern by heart the new words - Do exercises prediction Work in pairs...

Ngày tải lên: 21/06/2013, 01:27

3 934 0
Unit 1_ A visit from a penpal

Unit 1_ A visit from a penpal

... tsukudani, seafood or vegetables cooked and preserved in soy sauce, in _ to rice or noodles The Socialist Republic of Vietnam _of the former Democratic Republic of Vietnam (North Vietnam) ... A (LONG) _ civil war resulted in a victory for the Communist north, and (REUNIFICATE) _occurred in mid-1975  Rewrite these sentences: Lan & her pen-pal, Maryam started corresponding ... living in _ coexistence (PEACE) All the _ groups in the country live together in peace (RELIGION) The (DIVIDE) _ of Vietnam resulted from the defeat of the French by Communist-inspired...

Ngày tải lên: 26/06/2013, 01:27

4 552 0
Techical analysis from a to z

Techical analysis from a to z

... Introduction, Conclusion - Technical Analysis from A to Z 01/09/1999 INTRODUCTION - Conclusion Conclusion This concludes the Introduction to Technical Analysis I suggest you click on reference to continue ... an introduction to technical analysis that presents basic concepts and terminology The second half is a reference that is designed for anyone using technical analysis It contains concise explanations ... Introduction, Indicators - Technical Analysis from A to Z 01/09/1999 INTRODUCTION - Indicators Indicators An indicator is a mathematical calculation that can be applied to a security's price and/or...

Ngày tải lên: 13/08/2013, 15:59

227 662 0
Marketing insights from a to z 80 concepts every manager needs to know

Marketing insights from a to z 80 concepts every manager needs to know

... a Coke should mean an eight-ounce soft drink in the famous Coke bottle But ask today for a Coke and you will have to answer whether you want Coca-Cola Classic, Caffeine Free CocaCola Classic, ... soups can cannibalize the sales of the core soups without bringing in much additional revenue to cover the additional costs They can reduce operational efficiency, increase distribution costs, confuse ... Ad mock-ups can be tested for communication effectiveness using recall, recognition, or persuasion measures Postmeasurements strive to calculate the communication or sales impact of the ad campaign...

Ngày tải lên: 15/08/2013, 14:09

226 736 0
Evaluation of Nutrient Loads from a Citrus Orchard in Japan

Evaluation of Nutrient Loads from a Citrus Orchard in Japan

... water discharge and nutrient concentrations at these times are difficult Loads from diffuse pollution sources cannot be calculated accurately by weekly research, which is normally researched at ... in Case 1, we had to assume that the concentrations were constant during periods for which we lacked continuous data However the continuous water discharge data calculated from the automatically ... next case (Case 2)—evaluation from weekly researched concentrations and automatically recorded water levels—we obtained continuous water discharge data from the automatic water level records...

Ngày tải lên: 05/09/2013, 10:15

10 425 0
Nutrient Loss from a Tea Plantation Area in Japan

Nutrient Loss from a Tea Plantation Area in Japan

... Relationships between the specific flow and the specific loads of components were examined by the following empirical equation; L=cQn (1) where L is the specific load of the component (concentration multiplied ... type (n > 1, concentration increases with increase of flow), dilution type (n < 1, concentration decreases with increase of flow) and stable type (n = 1, concentration is roughly constant) Table ... multiplied by flow per catchment area, g/s/ha), Q is the specific discharge (discharge per area, m3/s /ha), and c and n are constants Runoff types are generally classified by the constant of n as washout...

Ngày tải lên: 05/09/2013, 10:15

10 344 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

... gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 (Probe) cggtgaatacgttcycgg ... cggtgaatacgttcycgg ggwtaccttgttacgactt cttgtacacaccgcccgtc Suzuki et al., 2000 Real-time PCR The microcystin-degrading bacteria were quantified by real-time PCR using QMF and QMR oligonucleotide ... able to detect the conserved sequence of mlrA, which breaks open the cyclic structure of microcystins, and have been used for detection and identification of microcystin-degrading bacteria in some...

Ngày tải lên: 05/09/2013, 10:15

9 522 0
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

... for scientific research and technological development research projects Reference number ENE2008-02274/CON Prof Francisco Javier Rey would like to thank the Consejería de Educación, Dirección ... (cool) Recirculation pump Secondary air stream Figure 11 Configuration of a regenerative indirect evaporative cooler c) Heat recovering indirect evaporative cooling: it consists of an indirect ... process, such as legionnaire’s disease or the device maintenance, but mainly to the strong prominence of other conventional cooling systems such as mechanic compression The necessity to reduce...

Ngày tải lên: 05/09/2013, 16:10

28 653 0
Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model

Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model

... volatile organic in the subsurface Environmental Science and Technology, 1995, 29 (3), 647-656 IARC, (2004) International Agency for Research on Cancer (IARC) Overall evaluation of carcinogenicity to ... of VOCs in landfills depend upon whether chemical reactions are occurring which either remove or create them Methane is highly explosive at concentrations of 5–15% in air [10] and can accumulate ... the time since closure (years) Note that for active landfills, c = 0, CNMOC = the concentration of NMOC (ppm by volume as hexane) The constant is a conversion factor to render the outcome of the...

Ngày tải lên: 05/09/2013, 16:11

8 540 0
w