... and size after resection, date of surgery, extent of surgical resection, risk group according to the classification proposed by Fletcher et al, the presence and date of local recurrence or distant ... prognostic factor for sarcomatosis Cancer 2002, 94:2441-2446 Chan JKC: Mesenchymal tumours of the gastrointestinal tract: a paradise for acronyms (GUMP, GIST, GANT, and now GIPACT) Implications of c- kit ... R, Cirilli C, Rashid I, Marcheselli L, Luppi G, Federico M: Incidence and clinicopathologic features of gastrointestinal stromal tumors A population-based study BMC Cancer 2007, 7:230 Pidhorecky...
Ngày tải lên: 09/08/2014, 01:24
... statistical significance, the finding may be random and the reason for publishing is of course to ask other researchers to look for the presence or absence of that specific association It is often ... The noticed effect of loratadine during the first period could be the result of a synergism with an unknown factor – a search for such a factor has yielded no likely candidate The second possibility, ... “exposures” (in this case drugs) and many outcomes (in this case different types of congenital malformations) it is to be expected that a number of apparently significant associations will occur In this...
Ngày tải lên: 31/10/2012, 17:03
Báo cáo y học: "TPO, but not soluble-IL-6 receptor, levels increase after anagrelide treatment of thrombocythemia in chronic myeloproliferative disorders"
... caused a reduction in platelet concentrations This hypothesis is supported by the recent findings of McCarty et al, who showed an effect of anagrelide on CD41 numbers and TPO-specific pTyr activity ... lack of correlation between the changes for platelet counts and TPO concentrations Thus, those who displayed the most pronounced platelet count reduction and achieving CR had the lowest increase ... by the manufacturer Anagrelide plasma concentrations were analyzed by York Bioanalytical Solutions, UK with a spectrometric method Statistical methods Changes in concentration of cytokines were...
Ngày tải lên: 03/11/2012, 10:52
Lập trình hướng đối tượng C/C++ - OOP 02 basic concepts of object
... c u tr c tr c C c bư c s d ng: ng: Khai báo l p (file h): t o ki u cho đ i tư ng ng class p> { ; tính>; ; c> ; }; C i đ t l p (file cpp): c i ... Nguy n Minh Huy 13 T mv c Dr Guru khuyên: khuyên: Quy t c h p đen: đen: Thu c tính c t m v c private đ h n ch truy xu t t Phương th c có t m v c public đ cung c p tính năng class PhanSo { private: ... ng l p Đ i tư ng gì? gì? Chương trình c máy” ph c t p máy” p C u thành t nhi u lo i “chi ti t” t” Chi ti t b n: hàm, c u tr c n: hàm, tr c Đã đ t o chương trình t t? t? Chi ti t m i: Đ i tư ng!!...
Ngày tải lên: 12/01/2014, 16:56
Tài liệu PLEISTOCENE VERTEBRATE FAUNAS OF HUNGARY pdf
... plicocaenicus Forsyth-Major a) lower molar of adult specimen; b)occlusal surface of the first molar of a young specimen; c) and d) lateral view of the first molar of the same specimens Characteristic ... them microstratigraphically in accordance with current practice, and therefore I will pass over these localities, which are mainly of secondary importance anyway Reliable microstratigraphic dating ... Pidoplicsko) Cervus s sp I1 (= cf Cervus philisi Schaub) I t is instructive to compare the fauna lists of locality no of Csarn6ta and locality no of Osztramos, since the former lies at a latitude of...
Ngày tải lên: 17/02/2014, 20:20
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... study The lectin is unique from that of other sialic acidspeci c lectins O-Acetyl sialic acid-speci c lectin was Ó FEBS 2003 A sialic acid speci c lectin from P jacquemontii (Eur J Biochem 270) ... mL fractions collected on ice in polypropylene tubes containing 100 lL of 100 mM CaCl2 at a rate of 0.3 mLÆmin)1 The presence of calcium chloride was required in the collected fractions because ... affinity of the humoral agglutinin BSM contains the sialic acids, N-acetylneuraminic acid, N-glycolylneuraminic acid, N-acetyl 9-O-acetylneuraminic acid and, 8,9-di-O-acetylneuraminic acid [6]...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx
... sites I of res as direct repeats, instead of two full res gd102NLS is also proficient to recombine sites I in the absence of accessory sites The efficiency of this reaction is significantly reduced, ... recombination in cell line TRE2/3 which contains a single copy of the vector The analysis was performed in the absence of doxycyclin, i.e the TRE-CMV promoter is active and transcription proceeds ... Micrococcal nuclease digestion of nuclei reveals extended nucleosome ladders having anomalous DNA lengths for chromatin assembled on non-replicating plasmids in transfected cells Nucleic Acids...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx
... the MUC5AC sequence With use of the primer pair 5¢-TATTCTAGAG AAGAGGGCCT GGTGTGCCGG AACCAGGACC AGCAGGGACC CTTCAAG-3¢ (GH262) and 5¢-ACGCGCTAGC TCAATGATGA TGATGATGGT GCATGGGGGA CACTGGGACG CC-3¢ ... a cDNA clone corresponding to the 3¢-end of human MUC5AC inserted into a pBluescript vector, was used as a template for PCR With use of the primer pair 5¢-GCTTCTAGAC ACGAGAAGAC AACCC ACTCC C- 3¢ ... part of the figure Dimer, dimeric M-MUC5AC-CH; Monomer, monomeric M-MUC5AC-CH; M-5AC-CH, reduced M-MUC5AC-CH; C2 -H, C- terminal cleavage fragment; M -C1 , N-terminal cleavage fragment The position of...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt
... insertion of a linker sequence formed by the oligonucleotides ZlibHisStop-1: 5¢-TCGACCCATCAT CATCATCATCATTAATAAGTCGAC-3¢ and ZlibHisStop-2: 5¢-TCGACGTCGACTTATTAATGATGATGA TGATGATGATGGG-3¢ encoding ... reference surface (ABD) was used to produce subtractive sensorgrams IgA-speci c affibody ligands (Eur J Biochem 269) 2649 Construction and production of dimeric (head-to-tail) affibody constructs The ... therapeutic use are currently under investigation in clinical trials [34] The majority of those are of IgG isotype, which can effectively activate complement- and antibodydependent cellular cytotoxicity...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt
... aI22 3C ⁄ cV5 8C aI22 3C ⁄ cL5 9C aN23 0C ⁄ cS6 6C aN23 0C ⁄ cT6 7C aN23 0C ⁄ cG6 8C aN23 0C ⁄ cI6 9C aN23 0C ⁄ cY7 0C aA23 3C ⁄ cI6 9C aA23 3C ⁄ cY7 0C aI23 7C ⁄ cV7 3C aG23 9C ⁄ cL7 6C aG23 9C ⁄ cI7 7C aL24 0C ⁄ cL7 6C ... aA23 3C ⁄ cI6 9C aA23 3C ⁄ cY7 0C aI23 7C ⁄ cV7 3C aG23 9C ⁄ cL7 6C aG23 9C ⁄ cI7 7C aL24 0C ⁄ cL7 6C aL24 0C ⁄ cI7 7C aL24 1C ⁄ cL7 6C aL24 1C ⁄ cI7 7C aL20 7C ⁄ cF5 4C aL20 7C ⁄ cI5 5C aN21 4C ⁄ cA6 2C aN21 4C ⁄ cI6 3C aN21 4C ... cI6 3C aN21 4C ⁄ cP6 4C aN21 4C ⁄ cM6 5C aN21 4C ⁄ cI6 6C aA21 7C ⁄ cM6 5C aA21 7C ⁄ cI6 6C aI22 1C ⁄ cG6 9C aI22 3C ⁄ cL7 2C aI22 3C ⁄ cY7 3C aL22 4C ⁄ cL7 2C aL22 4C ⁄ cY7 3C aI22 5C ⁄ cL7 2C aI22 5C ⁄ cY7 3C ++++ +++...
Ngày tải lên: 16/03/2014, 06:20
The queen of death
... N Professor Gamouchian Professor Gamouchian 'It was the custom to have a feast after a funeral in Ancient Egypt The great feast after the funeral of Queen Axtarte was held in the Temple of Karnak ... say that Piccadilly is the centre of the criminal world,' was Leila's reply Salahadin laughed and hurried out of the office He wanted to get a taxi before the lunchtime rush hour in Cairo began ... question which you can answer - you believe that Farrow has discovered the burial place of Queen Axtarte?' 'Farrow was a brilliant student at Cambridge He claims that he has discovered the Queen' s...
Ngày tải lên: 21/03/2014, 12:05
Student Displacement in Louisiana After the Hurricanes of 2005 ppt
... and Cameron) account for an additional 16 percent of the displaced Louisiana public school students, and the state’s remaining 71 local education agencies (parishes and special schools) account ... large percentage of black students and students who were achieving poorly before the hurricanes—characteristics of risk for academic failure SURVEY RESULTS The goals of the survey of principals ... how displaced students compared with the school’s preexisting students on demographic characteristics and achievement; the experiences of the displaced students in terms of attendance, social adjustment,...
Ngày tải lên: 23/03/2014, 03:20
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... residue of Rha at the branching point Elucidation of the structure of the O-speci c polysaccharide by NMR spectroscopy The 1 3C NMR spectra of OPS-I and OPS-II were essentially identical, and ... O-polysaccharide from Citrobacter braakii O6 (Eur J Biochem 270) 2735 Fig Part of a two-dimensional 1H,1 3C HSQC spectrum of the O-speci c polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional ... OPS of Citrobacter (Fig 3) One, from Citrobacter PCM 1487 and PCM 1528 (O5), is built up of branched trisaccharide repeating units, in which D-ara4dHex is attached as a sidechain to a GlcNAc residue...
Ngày tải lên: 23/03/2014, 17:22
Animesh Ranjan 5101045 C-2 (biotechnology) Jaypee Institute of Information Technology pptx
... academic as well as practical exposure and we look forward to more of such visits in future to enhance both our theoretical, technical and practical knowledge Alcoholic Beverages An alcoholic ... The consumption of alcohol is often important at social events in such societies and may be an important aspect of a community's culture The concentration of alcohol in a drink may be specified ... Danish scientist Hansen Nowadays there are two main varieties of yeasts that are used in brewing: saccharomyces cerevisiae and saccharomyces carlsbergensis (bottomfermenting) Certain other products...
Ngày tải lên: 24/03/2014, 04:20
Grief Dreams How They Help Heal Us After the Death of a Loved One pdf
... Eight, p 376) Archetypes Jung elaborated the concept of the collective unconscious by developing the idea of archetypes Archetypes are the structural elements of the collective unconscious, and they ... explained the collective unconscious as “the deposit of ancestral experiences from untold millions of years,” which reflected the deepest experiences of mankind (The Collected Works of C G Jung, ... guiding principle of Jungian theory and practice The Personal and Collective Unconscious Jung thought of the human mind in terms of the ego, the personal unconscious, and the collective unconscious...
Ngày tải lên: 29/03/2014, 04:20
This Time is Different, Again? The United States Five Years after the Onset of Subprime potx
... percent Cross-country real per capita GDP comparisons: 2007-2011 We next turn to comparisons between the US and other countries in the Second Great Contraction The simplest of cross-country comparisons ... 2011 Reinhart, Carmen M and Vincent R Reinhart, After the Fall,” in Federal Reserve Bank of Kansas City Economic Policy Symposium, Macroeconomic Challenges: The Decade Ahead at Jackson Hole, Wyoming, ... and Rogoff (2008) for 1946-2006 crises is replicated in the cross-country performance in the recent (2007-2011) crises: the systemic crises are associated with deeper more protracted recessions...
Ngày tải lên: 29/03/2014, 18:20
queen of air and darknesscharacter analysis
... different and balancingfeatures Gawaine is outgoing and quick to act, but he is balanced by Gaheris who isreclusive and slow to action Agravaine is sadistic and selfish, but he is balanced by Garethwho ... selfish, but he is balanced by Garethwho is kind and generous They compliment each other and together are stronger thanthey can ever be apart ...
Ngày tải lên: 02/04/2014, 17:58
egbers c., pfister g. (eds.) physics of rotating fluids
... include the C+ and C coalescence points and quartic bifurcation points which can occur at certain singularities of the system (32) Extended systems for these singularities may be found in Cliffe ... of experience guarantee authors the best possible service To reach the goal of rapid publication at a low price the technique of photographic reproduction from a camera-ready manuscript was chosen ... should check the contributions for the correct use of language At Springer-Verlag only the prefaces will be checked by a copy-editor for language and style Grave linguistic or technical shortcomings...
Ngày tải lên: 24/04/2014, 16:47
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... II 100 150 cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain II a g u u c 200 gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT 283 B Background1 Background2 Background3...
Ngày tải lên: 18/06/2014, 18:20