c—the getprotoent 3 demo program
Linux Socket Programming by Example PHẦN 4 ppt
... Socket Programming by Example - Warren W Gay 192 17: 18: 19: 20: 21: 22: 23: 24: 25: 26: 27: 28: 29: 30 : 31 : 32 : 33 : 34 : 35 : 36 : 37 : 38 : 39 : 40: 41: 42: 43: 44: 45: 46: 47: 48: 49: 50: 51: 52: 53: ... Linux Socket Programming by Example - Warren W Gay 171 10: 11: 12: 13: 14: 15: 16: 17: 18: 19: 20: 21: 22: 23: 24: 25: 26: 27: 28: 29: 30 : 31 : 32 : 33 : 34 : 35 : 36 : 37 : 38 : 39 : #include ... ( !(sp = getservent()) ) Linux Socket Programming by Example - Warren W Gay 165 21: 22: 23: 24: 25: 26: 27: 28: 29: 30 : 31 : 32 : 33 : 34 : 35 : 36 : 37 : 38 : 39 : 40: 41: 42: } break; } printf("%s:\n"...
- 51
- 899
- 1
An action research on the use of continuous feedback to improve the first year students' pronunciation at the english department, college of foreign languages, vietnam national university, hanoi part 1
... pronounced it in mind c looked at its pronunciation and meaning, then pronounced it aloud Part 3: Attitude and problems with English pronunciation How important is pronunciation you think? a ... Internet has some advantages and disadvantages Discuss with your partner about this IV Appendix 3: POSTTEST (MOCK SPEAKING TEST 2) Part one: Read aloud the following passage: Another feature of ... Shopping is a waste of time and money To what extend you agree with this statement? V Appendix 3: READING PASSAGES PASSAGE 1: JOB SATISFACTION Over the years, the development of different theories...
- 6
- 1,143
- 2
An action research on the use of continuous feedback to improve the first year students' pronunciation at the english department, college of foreign languages, vietnam national university, hanoi part 2
... it should not be treated as a major cause for the impossibility of generalization 3. 3 Background of the study 3. 3.1 Participants The participants of the research were selected on the basis of cluster ... could not be proper participants of the research program due to 35 their lack of participation in the very initial steps of it In addition, as the program was conducted extensively during the first ... news was the students were willing and determined to improve these weak skills 3. 3.2 The speaking and pronunciation programs A semester at the English Department lasted 15 weeks Four periods per...
- 76
- 1,069
- 2
AN ACTION RESEARCH ON THE APPLICATION OF COOPERATIVE LEARNING TO TEACHING SPEAKING TO THE SECOND YEAR SUDENTS AT THE DEPARTMENT OF ENGLISH, GIA LAI TEACHERS' TRAINING COLLEGE
... regards to the successes of CL implementing programs by thousands of teachers from many countries all over the world, I would like to carry out such a program in my department with a view to experiment ... give students any sort of meaningful practice in producing spoken English? (Brown and Yule 19 83: 3) Brown and Yule also draw a useful distinction between two basic language functions These are ... and interest, …etc.) PART 2: Role play 3 – minutes Now, I am going to give each of you a card on which there is a situation Role play the situation PART 3: general conversation based on the topic...
- 93
- 741
- 1
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf
... Aspergillus nidulans Curr Genet 13, 31 5 32 1 Devereux, J., Haeberli, P & Smithies, O (1984) A comprehensive set of sequence analysis programs for the vax Nucleic Acids Res 12, 38 7 39 5 Altschul, S.F., Gish, ... (5¢-GATGATCTACCCTCTGCTTC -3 and 5¢-GTC ACGGACGGACTGGGT -3 ) Northern analysis was performed as described previously [20] Per sample, lg of total RNA was loaded on the gel The A niger galA accession number is AJ30 530 3 ... incubation of mgÆmL)1 of potato, onion and soy arabinogalactan with 1 .33 lgÆmL)1 GALA at 30 °C, pH 4.5 (McIlvain buffer) for 15 min, 30 min, h and 20 h, respectively The incubation was stopped by heating...
- 9
- 669
- 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc
... Oligonucleotides used in this study Oligonucleotide Sequence (5¢ ) 3 ) Use SecPr-5 SecPr -3 viuB-5 viuB -3 desA-5 desA -3 desD-5 desD -3 Pf GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC ... wild-type Prototrophic wild-type SCP1–, SCP2– Hopwood et al [32 ] Hopwood et al [32 ] Gunter et al [16] Bentley et al [ 13] necessary S lividans 132 6 was used as a host for Streptomyces plasmid constructions ... followed by 94 °C for min; amplification, 30 to 40 cycles of 96 °C for 30 s, 55 °C to 67 °C (depending on the set of primers used) for 30 s, and 72 °C for 30 s to 1.5 Primers (19–24-mers) (Table...
- 13
- 456
- 0
Báo cáo khoa học: An intermediate step in the evolution of ATPases ) the F1F0-ATPase from Acetobacterium woodii contains F-type and V-type rotor subunits and is capable of ATP synthesis Michael Fritz and Volker Muller ¨ docx
... Bacteriol 179, 37 46 37 55 30 Reidlinger J (1994) Reinigung und Charakterisierung einer Na+-translozierenden F1F0-ATPase aus Acetobac- 34 28 31 32 33 34 35 36 37 38 39 40 41 42 43 44 terium woodii ... & Muller DJ (20 03) Fourteen ¨ protomers compose the oligomer III of the proton-rotor in spinach chloroplast ATP synthase J Mol Biol 33 3, 33 7 34 4 FEBS Journal 274 (2007) 34 21 34 28 ª 2007 The Authors ... Journal 274 (2007) 34 21 34 28 ª 2007 The Authors Journal compilation ª 2007 FEBS 12 14 0 -0.5 1.0 0.9 0.8 0.7 0.6 0.5 0.4 0 .3 0.2 0.1 0.0 0.5 1.0 LiCl (mM) 1.5 10 2.0 2.5 3. 0 12 34 23 Na+ F1F0-ATP...
- 8
- 486
- 0
Báo cáo toán học: "An improved bound on the minimal number of edges in color-critical graphs" pot
... Discrete Math 41 (1989), 37 1 39 6 [5] M Stiebitz, Proof of a conjecture of T Gallai concerning connectivity properties of colour-critical graphs, Combinatorica (1982), 31 5 32 3 ... 1)nL + knH ) = n − nL 2 Multiplying (5) by (k − 3k)/(k − 1) and summing with (4) we get 1+ k − 3k k k − 3k |E(G)| ≥ + n, k−1 k−1 or |E(G)| ≥ k 3 k−1 + n, − 2k − 1) 2(k (5) the electronic journal ... forthcoming paper [3] References [1] T Gallai, Kritische Graphen I, Publ Math Inst Hungar Acad Sci (19 63) , 265–292 [2] T R Jensen and B Toft, Graph coloring problems, Wiley, New York, 1995 [3] M Krivelevich,...
- 4
- 344
- 0
Explaining the effects of an intervention designed to promote evidence-based diabetes care: a theory-based process evaluation of a pragmatic cluster randomised controlled trial pot
... 0.56** 0.47** 0 .36 ** 0.21 0.47** 0.25 0.15 0.28* 0.25 0.07 0 .39 ** Indirect Measure 0.57** 0. 43* 0.29* 0 .34 * 0 .39 * -0.07 Mean (sd) 1.62(0.67) 2.62(1 .33 ) 2.69(1.81) 1.41(0. 63) 2.22(1 .32 ) 2.70(1.97) ... 0. 63* * 0.26 0.61** 0.22 0.77** 0 .33 * 0.49** 0.12 0.28* 0.25 0.48** 0.14 Indirect Measure 0.70** 0.66* -0. 03 0.64* 0.54* 0. 13 Mean (sd) 2.12(0.91) 2.99(1.44) 3. 00(1.51) 1.96(1.09) 2.64(1. 43) 3. 04(1. 73) ... 0. 03 0.67 0.50** 0.20 0.06 0.26 0.56*** 0.27 0.01 0.28 0.67*** 0.42 0. 03 0.45 0.62*** 0 .34 0. 03 0 .37 0.28* -0. 13 0.50*** 0.54*** 0.21 0.02 Attitude Subjective Norm PBC 0.14* 0.04 0.41* 0. 13 Attitude...
- 11
- 356
- 0
AN ACTION RESEARCH ON THE EFFECTS OF PRE WRITING ACTIVITIES ON THE GRADE – 11 NON – MAJOR ENGLISH STUDENTS’ MOTIVATION IN WRIT
... 6.6 16.6 (1) Least important → Most important (5) 2(%) 3( %) 4(%) 6.6 26.6 33 .3 13. 3 6.8 53. 3 40 20 26.7 33 .3 41.6 2.5 5(%) 33 .5 20 13. 3 32 a Warm – up activities b.Pre – writing activities c ... 14 I .3. 2.1 Teachers’ teaching methods 14 I .3. 2.2 Teachers’ knowledge 15 I .3. 2 .3 Teachers’ instructions .15 I .3. 3 External factors 16 I .3. 3.1 Time limitations ... 12 I .3. 1 Student factors 12 I .3. 1.1 Students’ learning styles 12 I .3. 1.2 Students’ motivation 13 I .3. 1 .3 Students’ language level 13 I .3. 2 Teacher...
- 58
- 868
- 6
Is Organizational e-Democracy Inevitable - The Impact of Information Technologies on Communication Effectiveness
... Paradox of Democracy in Organizational Research Over 100 years after de Tocqueville’s (1 835 ) discussion on the triumphs, hazards, and powers of democracy, Slater and Bennis (1964) argued that “democracy ... to enhance democracy in organizations? Human Relations, 47, 45- 63 Manville, B., & Ober, J (20 03) Beyond empowerment: Building a company of citizens Harvard Business Review, 81(1), 48- 53 Copyright ... prohibited 234 Watson, Schwarz, & Jones Markus, M.L (19 83) Power, politics and MIS implementation Communications of the ACM, 26, 430 -444 Mason, R.M (1982) Participatory and workplace democracy...
- 30
- 744
- 0
A study on the use of language activities to enhance 11th grade student's speaking skill in pham hong thai school, hung nguyen district, nghe an province
... research .46 3. 3 Data collection instruments .46 3. 3.1 Two developed research instruments 46 3. 3.2 Instrumental development 47 3. 3.2.1 The design of the ... 44 3. 1 Participants .45 3. 1.1 Survey questionnaire for students 45 3. 1.2 Students-Interviewees 45 3. 1 .3 Teachers- Interviewees 45 3. 2 Type ... 47 3. 3.2.2 Justification for two data collection instruments 47 3. 4 Descriptions .48 3. 4.1 Students 48 3. 4.2 Teachers 48 3. 5 Procedures...
- 98
- 807
- 6
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf
... 1999–2007 ª 2008 The Authors Journal compilation ª 2008 FEBS M Fritz et al 27 28 29 30 31 32 33 34 35 36 37 38 electrochemical proton potential Mol Microbiol 65, 1181–1192 Morgner N, Barth HD ... EMBO Rep 3, 1094–1098 Seelert H, Dencher NA & Muller DJ (20 03) Fourteen ¨ protomers compose the oligomer III of the proton-rotor in spinach chloroplast ATP synthase J Mol Biol 33 3, 33 7 34 4 Stahlberg ... c1 from Acetobacterium woodii Na+-F1F0-ATPase Subunits c1, c2, and c3 constitute a mixed c-oligomer J Biol Chem 275, 33 297 33 301 Fritz M & Muller V (2007) An intermediate step in the ¨ evolution...
- 9
- 773
- 0
Tài liệu Báo cáo khoa học: "An Experiment in Evaluating the Quality of Translations" pdf
... 8.00 8 .33 1.67 1.00 9.67 9 .33 7.00 6.67 I II 8.00 8.67 1 .33 1.00 9 .33 9.67 7.67 5 .33 I II 8.67 8.67 1.67 1 .33 10 .33 10.00 5.67 8.00 I II 3. 67 6 .33 3. 00 3. 33 6.67 9 .33 18.00 9 .33 I II 5 .33 8.00 ... automatic/slot mach machine 7 .33 4.00 2.00 4 .33 9 .33 8 .33 4.67 21.67 8.67 9.00 1 .33 1 .33 10.00 10 .33 4 .33 5 .33 7.00 8.00 2.00 2 .33 9.00 10 .33 7.00 4.00 7.00 7.67 2 .33 3. 00 9 .33 10.67 4.67 10.67 I II ... 1.4 133 MEAN READING Informativeness B 2.0641 0045 4145 037 7 50 53 1.7485 M 2.0150 [—.02 73] * 1.0277 0278 1.6424 3. 07 53 B 2.1 236 0104 533 6 0522 9924 3. 2705 TIMES PER SENTENCE M 36 .4706 [—.0678]* 30 .4790...
- 12
- 550
- 0
Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc
... regions Additionally allowed regions 132 .2, 151.6, 107.6 2.65 99.9 (99.9)a 31 5 465 63 426 7.8 (2.0) 8.7 (36 .9) 20.5 23. 6 16404 34 7 0.007 1 .38 8 a 32 .2 26.0 23. 4 87.9 12.1 Numbers in parentheses ... Ó FEBS 20 03 3D structure of indolepyruvate decarboxylase (Eur J Biochem 270) 231 3 Fig The indole -3- pyruvic acid pathway for the biosynthesis of the plant hormone indole -3- acetic acid in ... three helices, Ala387, Phe388 (helix a16), Val467, Ile471 (helix a20), Leu 538 , Leu542, and Leu546 (a 23) , and is completely buried in the protein Three of these residues (Phe388, Val467 and Ile471)...
- 10
- 557
- 0
Compiling the linux kernel
- 11
- 332
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25