... pronounced it in mind c looked at its pronunciation and meaning, then pronounced it aloud Part 3: Attitude and problems with English pronunciation How important is pronunciation you think? a ... Internet has some advantages and disadvantages Discuss with your partner about this IV Appendix 3: POSTTEST (MOCK SPEAKING TEST 2) Part one: Read aloud the following passage: Another feature of ... Shopping is a waste of time and money To what extend you agree with this statement? V Appendix 3: READING PASSAGES PASSAGE 1: JOB SATISFACTION Over the years, the development of different theories...
... it should not be treated as a major cause for the impossibility of generalization 3.3 Background of the study 3. 3.1 Participants The participants of the research were selected on the basis of cluster ... could not be proper participants of the research program due to 35 their lack of participation in the very initial steps of it In addition, as the program was conducted extensively during the first ... news was the students were willing and determined to improve these weak skills 3. 3.2 The speaking and pronunciation programs A semester at the English Department lasted 15 weeks Four periods per...
... regards to the successes of CL implementing programs by thousands of teachers from many countries all over the world, I would like to carry out such a program in my department with a view to experiment ... give students any sort of meaningful practice in producing spoken English? (Brown and Yule 19 83: 3) Brown and Yule also draw a useful distinction between two basic language functions These are ... and interest, …etc.) PART 2: Role play 3 – minutes Now, I am going to give each of you a card on which there is a situation Role play the situation PART 3: general conversation based on the topic...
... Aspergillus nidulans Curr Genet 13, 31 5 32 1 Devereux, J., Haeberli, P & Smithies, O (1984) A comprehensive set of sequence analysis programs for the vax Nucleic Acids Res 12, 38 7 39 5 Altschul, S.F., Gish, ... (5¢-GATGATCTACCCTCTGCTTC -3 and 5¢-GTC ACGGACGGACTGGGT -3 ) Northern analysis was performed as described previously [20] Per sample, lg of total RNA was loaded on the gel The A niger galA accession number is AJ30 530 3 ... incubation of mgÆmL)1 of potato, onion and soy arabinogalactan with 1 .33 lgÆmL)1 GALA at 30 °C, pH 4.5 (McIlvain buffer) for 15 min, 30 min, h and 20 h, respectively The incubation was stopped by heating...
... Oligonucleotides used in this study Oligonucleotide Sequence (5¢ ) 3 ) Use SecPr-5 SecPr -3 viuB-5 viuB -3 desA-5 desA -3 desD-5 desD -3 Pf GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC ... wild-type Prototrophic wild-type SCP1–, SCP2– Hopwood et al [32 ] Hopwood et al [32 ] Gunter et al [16] Bentley et al [ 13] necessary S lividans 132 6 was used as a host for Streptomyces plasmid constructions ... followed by 94 °C for min; amplification, 30 to 40 cycles of 96 °C for 30 s, 55 °C to 67 °C (depending on the set of primers used) for 30 s, and 72 °C for 30 s to 1.5 Primers (19–24-mers) (Table...
... Discrete Math 41 (1989), 37 1 39 6 [5] M Stiebitz, Proof of a conjecture of T Gallai concerning connectivity properties of colour-critical graphs, Combinatorica (1982), 31 5 32 3 ... 1)nL + knH ) = n − nL 2 Multiplying (5) by (k − 3k)/(k − 1) and summing with (4) we get 1+ k − 3k k k − 3k |E(G)| ≥ + n, k−1 k−1 or |E(G)| ≥ k 3 k−1 + n, − 2k − 1) 2(k (5) the electronic journal ... forthcoming paper [3] References [1] T Gallai, Kritische Graphen I, Publ Math Inst Hungar Acad Sci (19 63) , 265–292 [2] T R Jensen and B Toft, Graph coloring problems, Wiley, New York, 1995 [3] M Krivelevich,...
... Paradox of Democracy in Organizational Research Over 100 years after de Tocqueville’s (1 835 ) discussion on the triumphs, hazards, and powers of democracy, Slater and Bennis (1964) argued that “democracy ... to enhance democracy in organizations? Human Relations, 47, 45- 63 Manville, B., & Ober, J (20 03) Beyond empowerment: Building a company of citizens Harvard Business Review, 81(1), 48- 53 Copyright ... prohibited 234 Watson, Schwarz, & Jones Markus, M.L (19 83) Power, politics and MIS implementation Communications of the ACM, 26, 430 -444 Mason, R.M (1982) Participatory and workplace democracy...
... research .46 3.3 Data collection instruments .46 3. 3.1 Two developed research instruments 46 3. 3.2 Instrumental development 47 3. 3.2.1 The design of the ... 44 3. 1 Participants .45 3. 1.1 Survey questionnaire for students 45 3. 1.2 Students-Interviewees 45 3. 1 .3 Teachers- Interviewees 45 3. 2 Type ... 47 3. 3.2.2 Justification for two data collection instruments 47 3. 4 Descriptions .48 3. 4.1 Students 48 3. 4.2 Teachers 48 3. 5 Procedures...
... 1999–2007 ª 2008 The Authors Journal compilation ª 2008 FEBS M Fritz et al 27 28 29 30 31 32 33 34 35 36 37 38 electrochemical proton potential Mol Microbiol 65, 1181–1192 Morgner N, Barth HD ... EMBO Rep 3, 1094–1098 Seelert H, Dencher NA & Muller DJ (20 03) Fourteen ¨ protomers compose the oligomer III of the proton-rotor in spinach chloroplast ATP synthase J Mol Biol 33 3, 33 7 34 4 Stahlberg ... c1 from Acetobacterium woodii Na+-F1F0-ATPase Subunits c1, c2, and c3 constitute a mixed c-oligomer J Biol Chem 275, 33 297 33 301 Fritz M & Muller V (2007) An intermediate step in the ¨ evolution...
... regions Additionally allowed regions 132 .2, 151.6, 107.6 2.65 99.9 (99.9)a 31 5 465 63 426 7.8 (2.0) 8.7 (36 .9) 20.5 23. 6 16404 34 7 0.007 1 .38 8 a 32 .2 26.0 23. 4 87.9 12.1 Numbers in parentheses ... Ó FEBS 20 03 3D structure of indolepyruvate decarboxylase (Eur J Biochem 270) 231 3 Fig The indole -3- pyruvic acid pathway for the biosynthesis of the plant hormone indole -3- acetic acid in ... three helices, Ala387, Phe388 (helix a16), Val467, Ile471 (helix a20), Leu 538 , Leu542, and Leu546 (a 23) , and is completely buried in the protein Three of these residues (Phe388, Val467 and Ile471)...