cách dùng a small number of
Báo cáo sinh học: "An FPT haplotyping algorithm on pedigrees with a small number of sites" ppsx
Ngày tải lên: 12/08/2014, 17:20
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc
... this paper are those of the authors and are not necessarily those of the Reserve Bank of Australia. E-mail: FinlayR@rba.gov.au. 111 132 International Journal of Central Banking June 2012 Real and ... non-linear Kalman filter and apply it to Australia. The results suggest that long-term inflation expectations in Australia are well anchored within the Reserve Bank of Australia’s inflation target range ... economists. As argued, break-even inflation as derived directly from bond prices has a number of drawbacks as a measure of inflation expec- tations: such a measure gives average inflation over the tenor of...
Ngày tải lên: 15/03/2014, 07:20
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... to allow one missed cleavage per peptide, a mass tolerance of 0.5 Da, and for carbamido-methylation of cysteines to be considered as a fixed modification and oxidation of methio- nines as a variable ... Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against multidrug-resistant nosocomial bacterial strains. Antimicrob Agents Chemother ... the membrane of E. coli at their minimal antimicrobial concentrations, but rather traverse it, accumulate intracellularly, and damage a variety of essential vital processes to mediate the lethal event,...
Ngày tải lên: 16/03/2014, 00:20
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc
... and H2(x t )) are used to calculate a set of forecast observation points. This set of points is used to estimate a mean and variance of the data forecasts. ã The mean and variance of the data ... bond data. Adding forecast data helps to better anchor the model estimates of inflation expectations and so improves model fit. Inflation expectations as estimated in this paper have a number of advantages over ... expectations and inflation risk premia. Due to a lack of data we cannot do this and instead estimate inflation forward rates as part of our model. 4 where f i t,s is the instantaneous inflation forward rate...
Ngày tải lên: 22/03/2014, 20:20
Báo cáo hóa học: " Application of Evolution Strategies to the Design of Tracking Filters with a Large Number of Specifications" potx
... radar and aircraft characteristics be- cause of the very different behavior of any tracker for vary- ing input conditions. Radar parameters represent the accu- racy and quality of available data, ... to generate the best solution for a specific application to date, apart from manual parameterization and evaluation with simulation. Besides, real-world applications of tracking filters for ATC usually ... (PV). The design of a tracking filter aims at attaining a sat- isfactory trade-off among all specifications. The quality of the design will be evaluated by means of simulation over 22 test scenarios, producing...
Ngày tải lên: 23/06/2014, 00:20
Báo cáo chuyên đề xây dựng " A Numerical Analysis of The Wave Forces on Vertical Cylinders by Boundary Element Method " potx
... cylinders and two tandem cylinders for 0.1ka a) b) Free-Surface Elevation A Numerical Analysis of The Wave Forces on Vertical Cylinders by Boundary Element Method Msc. Cao Tan Ngoc Than* ** Graduate ... zone) Sketch of the incident, diffracted and reflected wave fronts for a vertically placed cylinder. Adapted from B. Mutlu(1997). incident wave incident wave Wave height distribution around two transverse ... ratio becomes larger than 0.2(Isaacson, 1979). LD/ Different flow regimes in the plane. Adapted from Isaacson (1979). )/,( LDKC II. Boundary Element Analysis Hiện tượng song nhiễu xạ(Diffraction...
Ngày tải lên: 26/07/2014, 07:20
Báo cáo toán học: "An Asymptotic Expansion for the Number of Permutations with a Certain Number of Inversions" docx
Ngày tải lên: 07/08/2014, 06:20
Báo cáo sinh học: "An approximate theory of selection assuming a finite number of quantitative trait loci" docx
Ngày tải lên: 09/08/2014, 18:21
Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot
Ngày tải lên: 14/08/2014, 17:22
Cách sử dụng (Something) is down to (a number of something) pdf
... bao gạo”. Thông thường bạn nói về số lượng sự vật/ đồ vật bị giảm, nhưng bạn cũng có thể liệt kê như: Now it’s down to just me, Claire, and Maria - Hiện giờ chỉ còn tôi, Claire và Maria. ... Công ty c a bạn v a gặp phải chút rắc rối. Phần lớn nhân viên trong bộ phận c a bạn đều bị sa thải. Và giờ chỉ có bạn, sếp c a bạn và 1 nhân viên n a. Bạn nói chuyện với bạn c a mình về tình ... van, so we’re down to two vehicles now - chúng tôi bán chiếc xe tải, vì thế giờ chúng tôi chỉ còn 2 chiếc xe. Hoặc về đồ ăn: “We’re down to half a bag of rice” = “chúng tôi giờ chỉ còn nửa...
Ngày tải lên: 10/03/2014, 11:20
MUCH, MANY, LOT OF, A LOT OF VÀ CÁC CÁCH DÙNG ĐẶC BIỆT
... Plenty of shops take checks. A large a mount of = a great deal of + non-count noun (formal English) I have thrown a large amount of old clothing. Mr Lucas has spent a great deal of time ... more of Ray and Barbara. (Rất hay khi được gặp Ray và Barbara thường xuyên hơn.) She has eaten most of that cake. Most of us thought he was wrong. Most cũng được dùng thay cho một danh ... the Far East. A lot và a great deal có thể được dùng làm phó từ và vị trí c a nó là ở cuối câu. On holiday we walk and swim a lot. The gorvernment seems to change its mind a great deal....
Ngày tải lên: 17/10/2013, 23:15
Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of docx
... plenty of time. * Plenty of shops accept credit cards. A large amount of, a great deal of , a large number of Cách diễn đạt này mang tính tương đối trang trọng. Sau A large amount of và a great ... * A lot of my friends live abroad. * Lots of time is needed to learn a language. Plenty of Plenty of mang ngh a : “đủ và nhiều hơn n a , theo sau đó là danh từ không đếm được và danh ... a great deal of là danh từ không đếm được. Ví dụ: * She has spent a great deal of time in Europe. Sau A large number of là trước danh từ số nhiều, và động từ theo sau nó cũng chia theo...
Ngày tải lên: 02/04/2014, 13:20
Cách sử dụng a lot of
... 3. A large amount of, a great deal of , a large number of - Cách diễn đạt này mang tính tương đối trang trọng. Sau A large amount of và a great deal of là danh từ không đếm ... dụ: * She has spent a great deal of time in Europe. - Sau A large number of là trước danh từ số nhiều, và động từ theo sau nó cũng chia theo chủ ngữ số nhiều: Ví dụ: * A large number of issues ... theo sau nó cũng chia theo chủ ngữ số nhiều: Ví dụ: * A large number of issues still need to be addressed. ...
Ngày tải lên: 16/05/2014, 22:03
Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of. potx
Ngày tải lên: 27/07/2014, 15:21
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... polymerase chain reaction. Med Sci Monit. 2001; 7: 345-9. 14. Ogawa Y, Itoh H, Nakagawa O, et al. Characterization of the 5'-flanking region and chromosomal assignment of the human brain natriuretic ... 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig. 1A) . The PCR ... declared that no conflict of in- terest exists. References 1. Kangawa K, Matsuo H. Purification and complete amino acid sequence of alpha-human atrial natriuretic polypeptide (al- pha-hANP)....
Ngày tải lên: 26/10/2012, 10:04
Bạn có muốn tìm thêm với từ khóa: