Ngày tải lên: 03/01/2014, 22:30
... Plenty of shops take checks. A large a mount of = a great deal of + non-count noun (formal English) I have thrown a large amount of old clothing. Mr Lucas has spent a great deal of time ... more of Ray and Barbara. (Rất hay khi được gặp Ray và Barbara thường xuyên hơn.) She has eaten most of that cake. Most of us thought he was wrong. Most cũng được dùng thay cho một danh từ, ... the Far East. A lot và a great deal có thể được dùng làm phó từ và vị trí c a nó là ở cuối câu. On holiday we walk and swim a lot. The gorvernment seems to change its mind a great deal....
Ngày tải lên: 17/10/2013, 23:15
Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of docx
... of time. * Plenty of shops accept credit cards. A large amount of, a great deal of , a large number of Cách diễn đạt này mang tính tương đối trang trọng. Sau A large amount of và a great ... * A lot of my friends live abroad. * Lots of time is needed to learn a language. Plenty of Plenty of mang ngh a : “đủ và nhiều hơn n a , theo sau đó là danh từ không đếm được và danh ... a lot rice left.) * There is not much rice left. (không phải là: There is not much of rice left.) A lot of - lots of Không có sự khác nhau nhiều gi a a lot of và lots of. A lot of và lots...
Ngày tải lên: 02/04/2014, 13:20
Cách sử dụng a lot of
... 3. A large amount of, a great deal of , a large number of - Cách diễn đạt này mang tính tương đối trang trọng. Sau A large amount of và a great deal of là danh từ không đếm ... dụ: * She has spent a great deal of time in Europe. - Sau A large number of là trước danh từ số nhiều, và động từ theo sau nó cũng chia theo chủ ngữ số nhiều: Ví dụ: * A large number of issues ... theo sau nó cũng chia theo chủ ngữ số nhiều: Ví dụ: * A large number of issues still need to be addressed. ...
Ngày tải lên: 16/05/2014, 22:03
Cách sử dụng A lot of, lots of, plenty of, a large amount of, a great deal of. potx
Ngày tải lên: 27/07/2014, 15:21
much, many, a lot of
... much/ many (nhiều) và most ( a phần). A lot of/ lots of (informal) = a great deal/ a large number of/ much/ many (formal). • Không có khác nhau gì mấy gi a a lot of và lots of. Chủ ngữ chính sau ... (formal English) I have thrown a large amount of old clothing. Mr Lucas has spent a great deal of time in the Far East. • A lot và a great deal có thể được dùng làm phó từ và vị trí c a nó ... sau hai thành ngữ này sẽ quyết định việc chia động từ. a lot of lots of | uncountable noun + singular verb | plural noun + plural verb A lot of time is needed to learn a language. Lots of us...
Ngày tải lên: 14/10/2013, 16:11
Tài liệu Much, many, a lot of và lots of – trong một số trường hợp khác pdf
... biệt alot/ lots of/ plenty/ a great deal với many/ much Các thành ngữ trên đều có ngh a tương đương với much/ many (nhiều) và most ( a phần). A lot of/ lots of (informal) = a great deal/ a large ... plenty of time . Plenty of shops take checks. • A large a mount of = a great deal of + non-count noun (formal English) I have thrown a large amount of old clothing. Mr Lucas has spent a great ... number of/ much/ many (formal). • Không có khác nhau gì mấy gi a a lot of và lots of. Chủ ngữ chính sau hai thành ngữ này sẽ quyết định việc chia động từ. a lot of lots of | uncountable...
Ngày tải lên: 12/12/2013, 22:15
Ôn thi TN 2011 - Chủ đề : many, much, a few, few, a little, little , most, most of, a number of, a great deal of…. pps
Ngày tải lên: 28/07/2014, 07:21
Camilla: A Tale of a Violin Being the Artist Life of Camilla Urso pdf
... her father and met Madam Sontag's party at Cincinnati. Aunt Caroline traveled with them as far as Louisville, Ky. Madam Sontag, who was greatly pleased with Camilla here offered to have a motherly ... West. As mother and daughter had been separated for a long time Madam Urso traveled with Camilla a portion of this journey. Unfortunately Madam Urso was taken sick at Cincinnati and for a while Camilla ... truth was hidden in the master's pleasantry. Camilla was rapidly distancing them all. She was the favorite scholar. She had the advantage of Massart's private instruction three times a week...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx
... Comparini C, Calamassi R, Pazzagli L, Cappugi G & Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f. sp. Platani. ... 341–346. 25 Pazzagli L, Cappugi G, Manao G, Camici G, Santini A & Scala A (1999) Purification, characterization, and amino acid sequence of cerato-platanin, a new phyto- toxic protein from Ceratocystis ... [e.g. cerato-platanin of Ceratocystis fimbriata f. sp. platani, Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and path- ogenesis-related proteins (As-CG of Coccidioides...
Ngày tải lên: 07/03/2014, 12:20
Bipolar Disorder – A Portrait of a Complex Mood Disorder Edited by Jarrett Barnhill docx
Ngày tải lên: 08/03/2014, 00:20
Báo cáo khoa học: Structure of FocB – a member of a family of transcription factors regulating fimbrial adhesin expression in uropathogenic Escherichia coli pdf
... per frame. Native data were collected to a resolution of 1.4 A ˚ . A total of 360 frames of data with an oscillation angle of 0.45° were collected. The exposure time was 0.5 s per frame. All datasets ... Frederick CA, Wang AH & Rich A (1987) A bifurcated hydrogen-bonded conformation in the d (A. T) base pairs of the DNA dodecamer d(CGCAAATTTGCG) and its complex with distamy- cin. Proc Natl Acad Sci ... bond length (A ˚ ) 0.017 rmsd bond angles (°) 1.61 Ramachandran plot favoured (%) 100 Ramachandran plot accepted (%) 0 Ramachandran plot outliers (%) 0 PDB code 3M8J a For replicate reflections,...
Ngày tải lên: 15/03/2014, 23:20
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc
... Thermoplasma volcanium. Proc.NatlAcad.Sci.USA97, 14257–14262. 49. Kawarabayasi, Y., Hino, Y., Horikawa, H., Yamazaki, S., Hai- kawa,Y.,Jin-n.,o,K.,Takahashi,M.,Sekine,M.,Baba,S., Ankai, A. , Kosugi, ... horikoshii;Pa,P. abissi;Ss,S. solfataricus;St,S. tokodaii;Ap,Aeropyrum pernix;Ta,Thermoplasma acidophilum;Tv,Ther- moplasma volcanium;Fa,Ferroplasma acidarmanus;Tm,Thermot oga mar itima;Aa,Aquifex aeolicus;Tt,Thermoanaerobacter ... K., Takahashi,M.,Sekine,M.,Baba,S.,Ankai ,A. ,Kosugi,H., Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima, K., Otsuka, R., Nakazawa, H., Takamiya, M., Kato, Y., Yoshizawa, T., Tanaka, T., Kudoh, Y., Yamazaki, J., Kushida, N., Oguchi,...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
... GGCAACGAGCAAGGTCCGAAG sapE–R 2590 R GACGTCGTGAGTGCCTCCGTG mopB–F 3103 F CGACGTGCAGTATTACTTTTCTAGGG mopB–R 3103 R AGTATCAAACCGTGCTGGTCTCC Heme protein identification in M. capsulatus O. A. Karlsen ... CCP-similar core. A similarity search against the translated GenBank nucleotide database (tBLASTn) revealed significant similarity between MCA2590 and an unannotated ORF of Methylomicrobium album ... NY. 33 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res...
Ngày tải lên: 23/03/2014, 11:20
Báo cáo hóa học: " A case of a speech impediment following a near lightning strike" ppt
Ngày tải lên: 20/06/2014, 22:20
BIPOLAR DISORDER – A PORTRAIT OF A COMPLEX MOOD DISORDER docx
Ngày tải lên: 27/06/2014, 11:20
Bạn có muốn tìm thêm với từ khóa: