các+câu+a+b+c+đều+đúng

... chất glucid thể người gồm: A < /b> Amylase, saccarase, cellulase B Saccarase, cellulase, lipase C Amylase, maltase, invertase D Lactase, saccarase, cellulase E Lactase, cellulase, trehalase 179 C c < /b> ... Glucose A < /b> Đúng B Sai 157 Số đồng phân monosaccarid th c tế 2n, n: số carbon b t đối A < /b> Đúng B Sai 158 Glucid tham gia tạo hình trong: A < /b> Acid nucleic B Glycoprotein C Glycolipid D C c < /b> c u < /b> B, C 81 Tr c ... hyaluronic, Condroitin Sulfat Dextran 81 C ng th c b n c u tạo c a:< /b> CH2OH CH2OH HO OH O OH A < /b> Saccarose OH B Lactose OH H OH C Maltose D Galactose E Amylose 81 Chất tính khử A < /b> Saccarose B Lactose...

Ngày tải lên: 23/03/2014, 07:20

... Breast cancer, LC- Lung cancer, NSCLC- Non small cell lung cancer, SSC- squamous cell carcinoma, CRColorectal cancer, CML- Chronic myeloid leukemia, GIST- Gastrointestinial stromal tumor, CTCL-Cutaneous ... myeloma Somatic mutations in the EGFR and have been associated with human bladder and cervical carcinomas Breakpoints of abnormal chromosomal translocation are also an important source of mutation ... Genetech BC [46] Her-2/neu Her-2/neu EGFR Madarex Genetech Imclone BC BC, PC, OC Pan .C, BC, RenC FDA approved Phase I Phase II Phase III [78] - PKC-α PKA ISIS Hybridon NSCLC, BC, Pan .C CR, Pan .C, ...

Ngày tải lên: 03/11/2012, 09:57

... (Dobles et al 2000) Upon checkpoint activation, both BubR1-Bub3 and Mad2 are capable of blocking the activity of APC /C through their direct binding to Cdc20 (Yu 2002; Bharadwaj and Yu 2004) Binding ... Aurora B/ Ipl1 and CENP-E Upon checkpoint activation both BubR1-Bub3 and Mad2 interact with Cdc20 and lead to an inhibition of APC Inactivation of the checkpoint occurs upon bipolar attachment to ... spindle checkpoint (Mad2, BubR1, and Bub3) form a < /b> complex that prevents entry into anaphase by binding to Cdc20, an essential activator of the anaphase-promoting complex (APC /C) The kinases Bub1 and...

Ngày tải lên: 25/10/2013, 21:20

... Plebani A,< /b> Soresina A,< /b> Rondelli R, Amato GM, Azzari C, Cardinale F, Cazzola G, Consolini R, De Mattia D, Dell’Erba G et al (2002) Clinical, immunological, and molecular analysis in a < /b> large cohort ... kinase as a < /b> cause of selective anti-polysaccharide antibody deficiency J Pediatr 139, 148–151 Ochs HD & Smith CI (1996) X-linked agammaglobulinemia A < /b> clinical and molecular analysis Medicine (Baltimore) ... FcepsilonRI-mediated mast cell activation FEBS J 278, 1990–2000 Quartier P, Debre M, De Blic J, de Sauverzac R, Sayegh N, Jabado N, Haddad E, Blanche S, Casanova JL, Smith CI et al (1999) Early and prolonged...

Ngày tải lên: 14/02/2014, 18:20

... (catalog number: SC-9996; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), Flag (catalog number: 3165; Sigma-Aldrich) and HA (catalog number: 1867423; Roche Diagnostics, Basel, Switzerland) were ... Tokyo, Japan) Transfected cells were visualized by EGFP fluorescence and immunocytochemical staining with anti-Flag or anti-HA sera Cell images were acquired by confocal microscopy (LSM510; Carl Zeiss, ... anti-(rabbit v-KIND) serum [12] was used at 0.5 lgÆmL)1 Antibodies against MAP 2a < /b> ⁄ b (catalog number: AP20; Sigma-Aldrich, St Louis, MO, USA), MAP2 (catalog number: M1406; Sigma-Aldrich), EGFP (catalog...

Ngày tải lên: 14/02/2014, 19:20

... and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement ... USA) and were each used as bait to screen an Arabidopsis pACT2 cDNA library [36] The yeast strain PJ69- 4A < /b> [37] containing either pBD-OXI1 or pBD-PTI1-4 was transformed with the pACT2 cDNA library ... incubated in kinase buffer and [c- 32P]-ATP MBP was used as an artificial substrate to assess the kinase activity and GST alone was used as a < /b> negative control The top panel shows the kinase assay...

Ngày tải lên: 14/02/2014, 19:20

... release of cytochrome c and subsequent activation of caspase-9 and caspase-3, which are cystein proteases that cleave vital cellular targets and cause apoptosis Caspases can be inhibited by members ... initiate apoptosis signaling by binding and antagonizing the anti-apoptotic Bcl-2 family members, thereby causing activation of Bax and Bak [23] Regulation of Bcl-2 family members can occur by a < /b> ... the caspase cascade and cellular destruction [22] To prevent cell death, Bax and Bak are bound and inhibited by the anti-apoptotic members of the Bcl-2 protein family (Bcl-2, Bcl-xL, Bcl-w, Mcl-1...

Ngày tải lên: 16/02/2014, 09:20

... and phPGK1–5aa–cerulean were constructed using the primers 5¢-CCGGA ATTCC AATGT CGCTT TCTAA CAAGC T-3¢ and 5¢-GGCGG ATCCA TAATA TTGCT GAGAG CATCC A-< /b> 3¢, and 5¢CCGGA ATTCC AATGT CGCTT TCTAA CAAGC ... and 5¢-CGGAA TTCCG ATGGG GAAGG TGAAG GTCG G-3¢, and 5¢-CGGAA TTCCG ATGGG GAAGG TGA AG GTCGG-3¢ and 5¢-CGACC GGTGT CTCCT TGG AG GCCAT GTGGG-3¢, respectively, and pcitrine-N1 phPGK1–7aa–cerulean ... inserted between the EcoRI and BamHI sites of pcerulean-N1 pcerulean–hPGK1 was constructed using the primers 5¢CCGGA ATTCG ATGTC GCTTT CTAAC AAGCT-3¢ and 5¢-GGCGG ATCCT TAAAT ATTGC TGAGA GCATC 1316 CHO-K1...

Ngày tải lên: 16/02/2014, 09:20

... myristoylation mutant (JSP1-G 2A)< /b> or a < /b> catalytically inactive mutant (JSP1-CS) were incubated with 32 P-labeled reduced carboxamidomethylated and maleylated lysozyme as substrate, and phosphatase activity ... FEBS 2469 Myristoylation regulates JSP1 function U Schwertassek et al caspase-8 molecules, resulting in their autocleavage and activation Active caspase-8 proteolytically processes and activates ... protein family, which induce permeabilization of the outer mitochondrial membrane Release of mitochondrial cytochrome c triggers assembly of a < /b> caspase-9activating complex and subsequent activation...

Ngày tải lên: 16/02/2014, 14:20

... 1B) A < /b> single chain of TtAKb contains two ACT domains, ACT1 (N-terminal domain) and ACT2 (C- terminal domain) domains The ACT domain organization of TtAKb-Thr is similar to that of CgAKb [20] but ... EcAKIII is shown as a < /b> dotted oval (C) Ca distance between TtAKb-Thr and TtAKb-free Blue indicates the distance between the A < /b> chain from TtAKb-Thr and the E chain from TtAKb-free, and red indicates ... inhibitors TtAKb has a < /b> denaturation temperature approximately 40 C higher than that of CgAKb (Table 2) Both CgAKb and TtAKb are more stable at 4.3–4.4 C in the presence of Thr Considering that...

Ngày tải lên: 18/02/2014, 08:20

... possible explanation for this apparent discrepancy could be that PKA phosphorylation induces a < /b> conformational change that increases the accessible hydrophobic surface area, enabling freer access ... Foster City, CA, USA) upon subcloning Recombinant virus was generated by transfecting Sf9 cells using the BaculoGold Transfection Kit (BD Biosciences Pharmingen, San Diego, CA, USA), according ... 5¢-AAG AAT TCT AGA TTA ATG GTG ATG ATG GTG ATG ATG GTG TGG GGT CAG CGG TGC AGC AGG GGG GGT-3¢ (XbaI sites underlined; His-tag in italic) and pVL1393–HSL [18] as template was digested using XbaI...

Ngày tải lên: 18/02/2014, 11:20

... detectable activity (Fig 3A)< /b> A < /b> colorimetric assay for cell viability, microscopic observation of cells, and an assay for caspase activity revealed that this dominant-negative kinase efficiently blocked ... antibody (clone 37), from BD Transduction Laboratories (San Jose, CA, USA); MKP-1 antibody (C- 19), from Santa Cruz Biotechnology (Santa Cruz, CA, USA); a-< /b> tubulin antibody (clone B- 5-1-2) and MAP ... resistance to AG1478 We also examined whether AG1478 could activate the effector caspase in M 1A4< /b> cells (Fig 6C) In PC-9 cells, activation of caspase was observed with a < /b> maximal increase (480%) at...

Ngày tải lên: 18/02/2014, 13:20

... replaced with alanines was used as a < /b> template Two sets of primers [set 1, 5¢-TAGTCCAG TGTGGTGGAATTCTGC-3¢ (sense) and 5¢-AAAGCATC AGGTTCCTTCTTAAG-3¢ (antisense); set 2, 5¢-AACTTT GCTGGCCGCCGCCGCTGG-3¢ ... (5¢-CUGAUGACCA GCAACUUGAdTdT-3¢) and antisense (5¢-UCAAGUUGC UGGUCAUCAGdTdT-3¢) oligonucleotides was denatured at 90 C, cooled for annealing, and used to knock down HIF- 1a < /b> Similarly, the siRNA against ... between bile acid uptake, efflux, and biosynthesis Maintenance of this balance is essential, as most bile acids are cytotoxic Cholestasis, a < /b> medical condition characterized by the impairment of normal...

Ngày tải lên: 18/02/2014, 13:20

... rat liver mitochondria: immunological characteristics and patterns of xenobiotic substrate metabolism Arch Biochem Biophys 339, 136–150 Anandatheerthavarada HK, Biswas G, Mullick J, Sepuri NB, ... signal-containing proteins to the mitochondrial compartment [4–6,12,39] We have shown that xenobiotic-inducible CYPs such as rat CYP 1A1< /b> , CYP2E1 and CYP 2B1 , and mouse CYP 1A1< /b> , contain chimeric noncanonical-targeting ... trichloroacetic acid The reaction product, formaldehyde, was measured as previously described [56] In all cases, both enzyme and zerotime blanks were also analyzed NDMA-d activity was assayed by...

Ngày tải lên: 18/02/2014, 16:20

... phosphorylates translation initiation factor (eIF5) Saccharomyces cerevisiae Yeast 20, 97–108 Bandhakavi S, McCann R, Hanna DE & Glover CVC (2003) A < /b> positive feedback loop between protein kinase CKII and ... anti-(myc agarose) and incubated in the presence of [32P]ATP[cP], separated by SDS ⁄ PAGE and autoradiographed (B) Coomassie Brilliant Blue-stained gel (C) Quantitative evaluation of phosphate incorporation ... HA3-Cka1p, [HA3-CKA1], or HA3-Cka2p, [HA3-CKA2], respectively Co-purified HA3-Cka1p or HA3-Cka2p was subsequently identified by immunodetection in a < /b> western blot using HA antibodies IgG, antibody...

Ngày tải lên: 18/02/2014, 16:20

... (5¢-GATTTTTGTGGCT GGAACAGGAAACCCATATTTTACAACTGATTCG) and F133N-rv (5¢-CGAATCAGTTGTAAAATATGGGT TTCCTGTTCCAGCCACAAAAAT), with the altered nucleotides shown in bold and underlined The F13 3A < /b> mutation ... mutation was created using the following primers: F133Afw (5¢-GTGGCTGGAACAGGAGCGCCATATTTTACA ACTGATTCG) and F13 3A-< /b> rv (5¢-CGAATCAGTTGTAA AATATGGCGCTCCTGTTCCAGCCAC) The mutations were verified by DNA sequencing ... in the central channel of the hexamer between B, C and F, and A,< /b> D and E The hydrophobic interactions between A < /b> and B (Fig 3A,< /b> B) are formed between the antiparallel a3< /b> -helices from each subunit,...

Ngày tải lên: 18/02/2014, 16:20

... pathway might enhance Ca2+ mobilization by reducing Ca2+ removal via sarco- and endoplasmic reticulum Ca2+-ATPase (SERCA) inhibition, in a < /b> similar way to that proposed for pancreatic acinar cells ... measured by western blot analysis, using a < /b> phosphoserine-473 Akt polyclonal antibody (Biosource International, Camarillo, CA, USA) to detect active Akt kinase, as well as a < /b> separate Akt polyclonal ... Z-Gly-Gly-Arg aminomethyl coumarin (Z-GGR-AMC) was from Bachem (Bubendorf, Switzerland); recombinant human tissue factor from Dade Behring (Marburg, Germany); and human thrombin calibrator from Synapse...

Ngày tải lên: 18/02/2014, 16:20

... (GAPDH) mRNA quantification in colon carcinoma and rectal carcinoma as compared to normal colonic tissue Colon carcinoma cells, rectal carcinoma cells and their normal healthy tissue counterparts ... the manufacturer’s suggested protocols The actin primers were as follows: forward, 5¢-CTACGTCGCCCTGGACTTCGAGC-3¢; reverse, 5¢-GATGGAGCCGCCGATCCACACGG-3¢ The DAPK1 primers were as follows: forward, ... anti-GST and anti-Flag (Sigma), and anti-PARP (Cell Signal) The ProteoExtract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) was used to extract proteins from mammalian cells according...

Ngày tải lên: 18/02/2014, 17:20

... TAC (Tyr) to TTC (Phe) with the forward primer: 3¢-GTCACAGAGCCACAGTTCCAG CCAGGA-5¢ Codon 305 of C- YES was mutated from AAA (Lys) to AGA (Arg) with the forward primer: 3¢-GG AACCACGAAAGTAGCAATCAGAACACTAAAACCA ... AACCACGAAAGTAGCAATCAGAACACTAAAACCA GGTACAATGATGC-5¢ All vector inserts were sequenced prior to use CDK4 pY17 antibody generation Murex lop-eared rabbits were injected with a < /b> phosphopeptide corresponding to amino ... purification steps were carried out at C and all chromatography steps were performed using an AKTA FPLC (Amersham Biosciences, GE Healthcare, Amersham, UK) All chromatography columns and media were...

Ngày tải lên: 18/02/2014, 18:20

... 5¢-GTAGGCATGAGAACGGGA AG-3 and for reverse 5¢-GGGGGTAAGAGGAGGAGA AA-3¢ and for CERK-negative forward 5¢-CCGCAAG AGGCTTTATTGTC-3 and reverse 5¢-TATGCCAAGGA CACGGAGAT-3¢, as a < /b> negative control PCR primer ... Sequences of the speci c primers included, for PPARb forward 5¢-GCAGCCTCTTCCTCA ATGAC-3¢, for reverse 5¢-GTACTGGCTGTCAGGGTG GT-3¢; CERK forward 5¢-TCTGCAAGGACAGACCCT CT-3, reverse 5¢-CAAGTGCCATTTGCTGAGAA-3¢; ... USA) A < /b> MEBCYTO Apoptosis Kit was purchased from Medical and Biological Laboratories (Nagoya, Japan), and a < /b> Nuclear Extract Kit was from Active Motif (Carlsbad, CA, USA) The ChIP Assay Kit was also...

Ngày tải lên: 18/02/2014, 18:20