by product of fruit juice industry as a flour fortification strategy
a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry
Ngày tải lên :
13/03/2014, 14:19
... are classified as variable costs today such as: direct labor, direct materials, and manufacturing overhead All of these will be divided equally based on some fixed criteria such as direct labor ... of plants are trying to broaden their capacity each year Generally, small companies not have so many capitals as a result; they can not expand their capacity With such kind of this company, adopting ... eyes and enhance the performance of the whole manufacturing companies Normally, if applying the traditional method, costs can be allocated not accuracy As a result, ABC increase the percentage of...
- 64
- 512
- 0
Báo cáo y học: " Status of complete proteome analysis by mass spectrometry: SILAC labeled yeast as a model system" ppt
Ngày tải lên :
14/08/2014, 16:21
... database This database was complemented with frequently observed contaminants (porcine trypsin, achromobacter lyticus lysyl endopeptidase and human keratins) A 'decoy database' was prepared by ... (where applicable) and N-pyroglutamate were allowed as variable modifications Due to the high mass accuracy, the 99% significance threshold (p < 0.01) in the yeast database search was a Mascot ... several fold interactions Figure of Degree sampling of SILAC peptide pairs Degree of sampling of SILAC peptide pairs Yeast was SILAC labeled as explained in Figure and one gel band was analyzed...
- 15
- 267
- 0
Microbiology of Fruit Juice and Beverages
Ngày tải lên :
25/10/2013, 21:20
... Higgins35 isolated several species of yeast, including Candida maltosa, Candida sake, Hanseniaspora guilliermondii, Hanseniaspora sp., Pichia membranaefaciens, Saccharomyces cerevisiae, and Schwanniomyces ... domestic and international market Microorganisms, particularly yeast and lactic acid bacteria, play a signiÞcant role in spoilage of fruit juice and beverages Pathogenic bacteria are usually not a problem ... 30 states, and Salmonella javiana associated with tomatoes affected 174 persons in four states.67,68 The illness was associated with consumption of contaminated cantaloupes in fruit salad and...
- 29
- 562
- 1
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
Ngày tải lên :
29/01/2014, 10:33
... test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed in turn The class ... for this task must have quite easy language and sung at a low speed such as ‘ whatever will be will be’ To carry out this task, teacher can omit some passage of the song word and then ask students ... years; teachers and researchers believe that motivation plays an important part in the process of acquiring an additional language because motivated students are usually those who participate actively...
- 39
- 1.1K
- 3
Tài liệu The Value of the Case Study as a Research Strategy doc
Ngày tải lên :
20/02/2014, 11:20
... are especially adamant that a case database be created and maintained to \allow repetition and re-evaluation of cases Reliability is most important during the data collection phase, and involves ... process of preparation, and has summarized major criticisms An epistemological base for analyzing the value of case study research programmes has been ruled out as a major threat because of inconsistencies ... in an Administrative Science Quarterly article titled 'Qualitative data as an attractive nuisance' that research based upon case study was unlikely to transcend story-telling Is case study a valid...
- 15
- 587
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
Ngày tải lên :
06/03/2014, 09:22
... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 5428–5437 ... GAR ESS3 hnRNP A1 ASF ⁄ SF2 hnRNP H hnRNP A1 SC35, SRp40 ASF ⁄ SF2, SRp40 hnRNP A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency...
- 10
- 434
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
Ngày tải lên :
06/03/2014, 22:21
... b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA ... AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT ... particularly, clear cell adenocarcinomas, cervical squamous carcinomas, ovarian carcinomas, colorectal carcinomas, esophageal carcinomas, bladder carcinomas and non-small cell lung carcinomas CA9...
- 13
- 563
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
Ngày tải lên :
07/03/2014, 10:20
... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab in regulating ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors...
- 9
- 634
- 0
Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf
Ngày tải lên :
07/03/2014, 12:20
... k1), as seen experimentally In analogy with the values calculated in enzymatic experiments, an increase of % 0.5 pK units of the His57 in DK9 mutant was also calculated analyzing the NAPAP data ... N -a- (2-naphthylsulfonylglycyl)-4-amidinophenylalanine-piperidine (a- NAPAP) [2,8] As shown in Fig 1D, the pH dependence of a- NAPAP binding was characterized by a bell-shaped curve The best-fit pKa values calculated from this data set (Table ... ˚ mutant (average SAS ¼ 24.9 A2 ) than in the WT form ˚ 2) A similar trend was observed (average SAS ¼ 9.3 A ˚ for Trp29 (average SAS ¼ 9.6 and 14.1 A2 in WT and DK9, respectively), whereas the...
- 11
- 553
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
Ngày tải lên :
23/03/2014, 15:21
... Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride ... Chloroplast DNA Euglenophyceae Euglena gracilis Chloroplast DNA Chlorophyceae (green algae) Chlamydomonas reinhardtii Nuclear DNA Chloroplast DNA Higher plant Oryza sativa Nuclear DNA Chloroplast DNA ... found in a primitive green alga, P parkeae as well as E garcilis, C reinhardtii and spinach in the present immunological assays Experimental procedures Preparation of antibodies against various...
- 11
- 501
- 0
Subcoal ® from coarse rejects of the paper industry as fuel for limekilns doc
Ngày tải lên :
24/03/2014, 05:20
... study by CE Delft (CE, 2000), the Subcoal® route for paper-plastic fractions (PPF) of a waste sorting installation has been environmentally analysed and compared to alternative waste disposal routes ... used as secondary energy source in industrial furnaces, such as limekilns and cement kilns, coal-fired power plants and blast furnaces Subcoal® has a caloric value comparable with lignite In a previous ... a waste incineration plant (WIP) A previous study by CE Delft revealed that for the paper-plastic fraction of household waste, the Subcoal® route has a better climate and overall environmental...
- 23
- 298
- 0
báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot
Ngày tải lên :
20/06/2014, 15:20
... status and discharge from the military Smoking status at the one-year follow up was assessed using a 7-day point prevalence analysis [16] Discharge was assessed both after BMT and after technical ... summary, a single-item self-assessment of health was consistently related to a variety of health parameters important to the military Used at a population level, this brief health status measure may ... healthcare needs of all military healthcare beneficiaries and to target specific health issues For instance, the Health Care Survey of DoD Beneficiaries [8] assesses a broad range of healthcare...
- 9
- 301
- 0
Báo cáo hóa học: " Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer" potx
Ngày tải lên :
21/06/2014, 08:20
... Vigneshwaran N, Ashtaputre NM, Varadarajan PV, Nachane RP, Paralikar KM, Balasubramanya RH: Mat Lett 2007, 61:1413 17 Bhainsa KC, D’Souza SF: Coll Surf B Biointer 2006, 47:160 18 Shankar SS, Ahmad A, ... Cite this article as: Verma et al.: Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer Nanoscale Res ... of Medical Sciences, Banaras Hindu University, Varanasi 221005, India 2School of Material Science and Technology, Institute of Technology, Banaras Hindu University, Varanasi 221005, India 3National...
- 7
- 261
- 0
Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot
Ngày tải lên :
07/08/2014, 18:21
... :2 esahP gnilpmas fo yad emas eht no deyassa dna ,C°02− ni derots erew selpmas amsalp ehT amsalp eht etarapes ot g × 005,1 yletamixorppa ta nim 51 rof degufirtnec saw elpmas hcae ,noitcelloc ... dohtem yassa lacigoloiborcim a gnisu denimreted erew snoitartnecnoc emipefec amsalp ehT o dohtem lacitylanA esahp ni sa demrofrep erew serudecorp gnilpmas eht dna esod emas eht ta ylralucsumartni ... ehT )ASU ,SSPS ;0.2 noisrev( tatsamgiS ,margorp lacitsitats eht gnisu dezylana saw atad eht llA )deliat-owt( tset deriap a gnisu derapmoc erew noitcefni eht retfa dna erofeb deniatbo seulav citenikocamrahp...
- 5
- 205
- 0
Báo cáo khoa học: "Bony metastases from breast cancer - a study of foetal antigen 2 as a blood tumour markerl" doc
Ngày tải lên :
09/08/2014, 03:21
... patients with both skeletal and extra-skeletal metastases FA-2 Assays The serum samples were transported at -20°C to the Williamson Laboratory at St Bartholomew's Hospital FA-2 radioimmunoassays ... women and this was due to marked elevation in women with metastatic breast cancer (Table 2) Women with metastatic disease had a much higher value of FA-2 than those without (Table 3) and this was ... metastases Page of Sample category N Mean ± SD p value (AU/ml) Preparation of Serum Samples Blood obtained by venesection was collected in plain tubes, allowed to stand for at least 30 minutes and...
- 4
- 286
- 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
Ngày tải lên :
09/08/2014, 06:22
... epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis ... peptide-based assay (99.8%; data not shown) Further studies are in progress to compare the assay performance of the anti-SMP assay with that of other commercially available anti-Sm immunoassays For ... high-performance liquid chromatography The molecular mass was found to be 1708.1 Da (average; Precision and reproducibility Measurements of imprecision (interassay and intra-assay variability) were taken...
- 11
- 593
- 0
báo cáo khoa học: "Malignant fibrous histiocytoma of the urinary bladder as a post-radiation secondary cancer: a case report" pdf
Ngày tải lên :
10/08/2014, 22:20
... found sarcomatoid components in high-grade urothelial carcinomas, and limited clinical information available From gross pathological examination, the mass was obviously unlikely for carcinomas, as ... pelvic cavity at the levels of the neoplasm was detected at the L5 spine level, and palliative radiation therapy in that area was suggested Despite aggressive surgical treatment along with adjuvant ... Curado FJ, López Beltrán A, Prieto Castro R, Regueiro López JC, Leva Vallejo M, Alameda Aragoneses V, Blanco Espinosa A, Moreno Arcas P, Requena Tapia MJ: Malignant fibrohistiocytoma of the bladder...
- 6
- 493
- 0