Ngày tải lên: 30/07/2014, 12:22
... creating a success from the plan. Building your education and training as an adjunct to the plan- ning model prevents what I call random or event training. Huge amounts of training are conducted each ... Training What I found worked well at a Midwest business-to-business cata- logue sales company was to separate the training into two major groupings. Over a three-year period Ralph Cannon, the ... high-perfor- mance level as measured against business goals. For this vertical and horizontal training integration to work, he made sure the informa- tion had continuity down the management chain to...
Ngày tải lên: 24/10/2013, 09:20
Natural botanical products have a long history in the world and are featured in using a complex
... proliferation of gastric cancer cells. However, further clinical trials in humans are needed to examine the pharmacokinetics and the therapeutic action of CKBM on cancer patients. Competing interests ... for 90 min, and then incubated with Link reagent (LSAB kit, DAKO) for 60 min at room temperature. Sections were incubated with Streptavadin (LSAB kit, DAKO) for 60 min, and further incubated with ... Statistical analysis Statistical significance between the treatment groups was analyzed using a two-way statistical analysis of variance (ANOVA), followed by Dunnett t-test and post-hoc analysis...
Ngày tải lên: 03/11/2012, 09:54
A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA
Ngày tải lên: 05/09/2013, 09:08
Focus - A simplicity manifesto in the Age of Distraction
... ideas, you gather the raw materials for creating. But consuming and communicating aren’t creating. They aid creating, they lay the groundwork, but at some point we need to actually sit down and ... prima donna or “diva” for not wanting to be available through email. Interesting: the simple act of giving up email was either hugely courageous, or arrogant, because I wasn’t living up to the ... expectation of society that I’d be available via email and at least make the attempt to reply. Interesting, because just a decade earlier, many people didn’t use email and no one cared if they...
Ngày tải lên: 05/01/2014, 15:25
Tài liệu Building a RISC System in an FPGA ppt
... minimize the datapath area be- cause the adder, with the immediate mux, can do the effective address add, and the PC incrementer can also add branch displacements. The memory address mux can help load ... using a jump. Because insert- ing a jump may make other branches far, we repeat until no far branches remain. Next, we evaluate fixups. For each one, we look up the target address and apply that ... the A and B operands, and latch them in the A and B registers. Some examples are shown in Table 5. The A operand is AREG unless (as with add 2 ) the instruction depends on the result of the previous...
Ngày tải lên: 26/01/2014, 14:20
Tài liệu Building a RISC System in an FPGA Part 2 docx
... CTRLFSM also has several other bits of state: ã DCANNUL: annul DC stage ã EXANNUL: annul EX stage ã DCINT: int in DC stage ã DMAP: DMA transfer pending ã INTP: interrupt pending DCANNUL and EXANNUL are ... select the A and B operands. If the instruction is a branch, CTRL determines if it is taken. Then as the pipeline advances, the instruction passes into EXIR. In the EX stage, CTRL drives ALU and ... pipeline clock enable. Most datapath registers are enabled by PCE. It indicates that all pipe stages are ready and the pipeline can advance. PCE is asserted when RDY signals completion of the last...
Ngày tải lên: 26/01/2014, 14:20
Tài liệu Building a RISC System in an FPGA Part 3 doc
... clocks later, the CPU performs the DMA load, asserting ACK. The video data word is latched in the PIXELS staging register. On the eighth clock, this word is loaded into the PMUX 8 ì 2 parallel-load ... MEMCTRL, accessing instruction and data via the on-chip bus D 15:0 or external SRAM. Integrated peripherals provide parallel port I/O and on-chip RAM. The VGA controller fetches pixel data via DMA. Tables ... the FPGA and running a demo program that’s drawing graphics on the monitor. request new pixel data via the DMA controller. The rest are the VGA video outputs. The red, green, and blue intensities...
Ngày tải lên: 26/01/2014, 14:20
Tài liệu Piper in the Woods ppt
... of clouds and a gentle wind moved through the cedars along the bank of the stream. There was a path leading from the hospital building down the slope to the stream. At the stream a small bridge ... field attendant was already busy opening the storage compartment of the patrol ship, extracting his trunk. The attendant lowered the trunk into a waiting dolly and came after him, manipulating the ... Chief Watts said, "you'll find your- self back at the Garrison in about six hours. It's a damn small aster- oid. There's a couple of streams and lakes, so don't fall in. " "How...
Ngày tải lên: 17/02/2014, 09:20
Tài liệu SOCIAL MEDIA AND BRAND AWARENESS - A CASE STUDY IN THE FAST MOVING CONSUMER GOODS SECTOR docx
... that will be the winners in the battle of raising brand awareness (Aaker 1996). Weber (2009) argues against the “traditional way” of looking at brand equity in terms of brand recall- and instead ... necessary primary and secondary data. The most important findings were that the theoretical framework does explain how the company in the case study uses social media to create brand awareness. The ... brand awareness. Företaget lyfter fram att utmaningen ligger i att vara relevant i sociala medier och i alla andra kommunikationskanaler, vilket handlar om att hitta den räta balansen mellan...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Building a Spatial Database in PostgreSQL pptx
... Spatial data and spatial databases ã Adding spatial extensions to PostgreSQL ã OpenGIS and standards Spatial Relationships Containment: Rivers inside watersheds and land (islands) inside lakes ... the previous data Spatial Relationships Adjacency: All the lots which share an edge Why put spatial data in a RDBMS? ã Spatial data is usually related to other types of data. Allows one to ... A Dynamic Index Structure for Spatial Searching', Proc ACM SIGMOD Int. Conf. on Management of Data, 1984 Spatial Relationships Distance to various pubs Topic Three Combination of all the...
Ngày tải lên: 20/02/2014, 05:21
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
... Sulfated and nonsulfated glycosamino- glycans (GAGs) from the supernatant were estimated by the Whiteman Alcian blue binding technique [28,29], using chondroitin sulfate as standard. The assay was ... expressed as a mole percent, represent the average of at least three independent determinations. The amount of protein in each extract was calculated from the amino acids’ molar yields. Glycosaminoglycan ... water-soluble matrix, water-insoluble matrix, the EDTA-soluble matrix and the EDTA- insoluble matrix of Pinctada maxima nacre. Results are expressed as a mole percent and represent the mean of at least...
Ngày tải lên: 21/02/2014, 01:21
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... over the mutant, indicating the ratios of the ATP synthesis rates, are plotted for the exp eriments in the absence (dashed line) or in the presence (continu ous line) of valinomycin. As n o ATP synthesis ... evaluated by a dding 10–25 n M standard ATP. ATP synthesis induced by acid-base transitions Acid-base driven ATP synthesis was carried out similarly as described in [ 36] by rapidly injecting an ... decreasing the reaction temperature to 13 °C, and the transition was carried out manually by rapidly injecting the acidic chromatophores suspension into the luminometer cuvette containing the b asic...
Ngày tải lên: 21/02/2014, 03:20
Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc
... Page 21 chapparal changed to chaparral | | Page 22 chapparal changed to chaparral | | Page 27 chapparal changed to chaparral | | Page 28 Twigg's changed to Twiggs's | | Page 29 chapparal ... that place after the war ended, I obtained knowledge which enabled me to clear up all accounts against the estate of Captain Swift. The amount of that nominal indebtedness far exceeded the value ... to at | | Page 9 Camargo changed to Carmargo | | Page 10 Camargo changed to Carmargo | | Page 11 montly changed to monthly | | Page 11 chapparel changed to chaparral | | Page 12 chapparal changed...
Ngày tải lên: 21/02/2014, 08:20
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx
... analysing information about what the learner can do, what they understand and the progress they are making at any particular point in their de- velopment. Documentation and evaluation can assist early ... outcomes. Who are learners of English as a second language? Standard Australian English is the national language of Australia and it is essential that all children grow- ing up in Australia have access ... important to be bilingual? 9 Maintaining the first language in children under three 10 Maintaining the first language in years prior in children age three to six years 11 Learning English as a second...
Ngày tải lên: 24/02/2014, 18:20
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... underline). Name Size (nt) Sequence CLL 121 5Â-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3Â GTL 121 5Â-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3Â GCL ... 5Â-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3Â GCL 121 5Â-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA CCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3Â CLE ... 5Â-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGA CCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3Â CLE 61 5Â-GCCTCGTTCCGGCTAAGTAACATGGAGCAG GTCGCGGATTTCGACACAATTTATCAGGCGA-3Â GTE 61 5Â-TCGCCTGATAAATTGTGTCGAAATCCGCGA TCTGCTCCATGTTACTTAGCCGGAACGAGGC-3Â GCE...
Ngày tải lên: 07/03/2014, 12:20