box select the admin group in the group name list

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

... decision  making  process  begins with the recognition and the definition  of the problem. This stage is in the intelligence  phase  of  decision  making  and  it  involves  in searching  the decision  ... 0.998  The final step in evaluating the measures  is  to  determine  the weights  for  the alternatives. By referring to the standardized  scores in Tables 5 and 7, and scoring card of  combinations  ... antibiotics.  The excess of these substances will remain in the water  and  will  also  get  in the sludge  on  the bottom of the shrimp ponds. By reducing the feeding  and  the antibiotics,  less ...

Ngày tải lên: 22/03/2014, 12:20

13 488 0
Unit 1: A day in the life of. Listening

Unit 1: A day in the life of. Listening

... WHILE-LISTENING Pre order these pictures WHILE-LISTENING Listen and order these pictures WHILE-LISTENING Listen again and decide whether the statements are True (T) or False (F) Mr Lam lives in ... routine:/ru:'ti:n/ pedal:/'pedl/ office:/'ɔfis/ food stall:/fu:d stɔ:l/ purchase:/'pə:t∫əs/ drop:/drɔp/ passengers:/'pæsindʒə/ ride:/raid/ WHILE-LISTENING Look at the pictures and describe them ... PRE-LISTENING WHO IS HE? - He gets up very early - He has got a cyclo - He usually has meals at a foot stall - He drives passengers to everywhere they want HE IS A CYCLO DRIVER PRE-LISTENING Listen...

Ngày tải lên: 21/06/2013, 01:26

10 12,6K 39
Top Job Interview Questions to Help You Select the Best

Top Job Interview Questions to Help You Select the Best

... discussion straying off course or eliciting information you don’t want about potential job discrimination topics, bring the discussion quickly back on topic by asking another job-related interview ... illnesses in the past year? During an interview, you must take care to keep your interview questions focused on the behaviors, skills, and experience needed to perform the job If you find your ... hired for the position which is why I am comfortable sharing the examples.) Interested in legal behavioral based interview questions? I also provide guidance about what you are looking for in your...

Ngày tải lên: 20/09/2013, 01:10

2 465 0
Unusual Job Interview Questions Help Select the Best

Unusual Job Interview Questions Help Select the Best

... why? In the news story of your life, what would the headline say? Behavioral Job Interview Questions Simply, behavioral interview questions ask how the candidate handled similar situations in the ... thinking as your solved it • • • • • • Tell me about a creative solution you developed for a challenging situation or problem Describe a situation working in a group or team where there was interpersonal ... of thinking How did you accomplish this? What was the outcome? Behavioral job interview questions are your best approach during candidate job interviews But, the occasional unusual job interview...

Ngày tải lên: 20/09/2013, 01:10

3 392 0
Báo cáo khoa học: A new rice zinc-finger protein binds to the O2S box of the a-amylase gene promoter pptx

Báo cáo khoa học: A new rice zinc-finger protein binds to the O2S box of the a-amylase gene promoter pptx

... protein We believe that the O2S -box binding domain is present in the protein This His192 abolished the binding of the protein to the O2S conclusion is supported by the observations that the RAMY ... Fig DNA binding is mediated by the zinc finger domain (A) SDS/ PAGE showing the purity of the recombinant GST-fusion proteins (lanes 2–6) The GST-fusion proteins were over-expressed in E coli ... Screening for rice cDNA encoding the O2S binding protein To isolate genes whose products bind to the O2S domain (ATTGACTTGACCGTCATCGG) in the Amy54 gene promoter, two plasmids were used in the...

Ngày tải lên: 16/03/2014, 18:20

7 359 0
Native or Web app: How to Select the Right Platform for Your Enterprise Mobile Apps

Native or Web app: How to Select the Right Platform for Your Enterprise Mobile Apps

... while leveraging the investment in the existing eCommerce system In the case of Walmart, their engineering team also chose hybrid to leverage their existing mobile web development efforts The checkout ... there are conflicting accounts on the reason for the transition On the technical side, Facebook’s engineering staff have pointed the finger at their app’s main user interface, the newsfeed Despite ... a “synthetic API” created by using a t.engine to translate the existing site into JSON In both cases, a transform engine also powers the company’s mobile web sites unifying the mobile initiatives...

Ngày tải lên: 21/07/2014, 12:06

26 363 0
the box  how the shipping container made   marc levinson

the box how the shipping container made marc levinson

... business with the tobacco industry.9 Cost-saving innovations continually materialized as McLean Trucking grew The company opened one of the earliest automated terminals in the industry, in WinstonSalem, ... cargo in 1953, and then sank again under the weight of stringent work rules.21 The solution to the high cost of freight handling was obvious: instead of loading, unloading, shifting, and reloading ... rethinking of the entire process “[P]erhaps the remedy lies in discovering ways of packaging, moving and stowing cargo in such a manner that breakbulk is avoided,” they wrote.29 Interest in such...

Ngày tải lên: 22/07/2014, 21:21

319 297 0
Báo cáo sinh học: "The bacterial pathogen Listeria monocytogenes: an emerging model in prokaryotic transcriptomics" pptx

Báo cáo sinh học: "The bacterial pathogen Listeria monocytogenes: an emerging model in prokaryotic transcriptomics" pptx

... [15] investigating the transcriptomes of Listeria grown in vitro in several conditions (including exponential and stationary phase, low O2, two temperatures), in vivo (in the intestine of germ-free ... sequencing - that is, RNA-seq to investigate the sigma B regulon in the 10403S L monocytogenes strain, a strain that, like strain EGD-e, has been extensively used to investigate Listeria virulence The ... overlaps an open reading frame [17] It is interesting to note that tmRNA and 6S RNAs are implicated in recovery from the stress induced by entry into stationary phase in E coli and in the adaptation...

Ngày tải lên: 06/08/2014, 19:21

4 342 1
Improving the cost management accounting in the plastic corporations listed on vietnam stock market

Improving the cost management accounting in the plastic corporations listed on vietnam stock market

... the world have been presented in detail in Chapter In the opinion of the author, the learning and applying the cost management accounting systems from other countries also need time and routine, ... accounting within the organization In this thesis, to assist the study and assessment of cost management accounting in the plastic joint stock company listed in Chapter 3, in this chapter the author ... planning, guiding, promoting and controlling staff In fact, the information of cost management accounting plays an essential role for the managers to make decisions in the planning process, guiding,...

Ngày tải lên: 30/12/2014, 22:01

12 301 0
alhazaimeh et al - 2014 - the impact of cg and ownership structre on voluntary disclosure in annual reports among listed jordanian companies

alhazaimeh et al - 2014 - the impact of cg and ownership structre on voluntary disclosure in annual reports among listed jordanian companies

... nations Indeed, Jordan was one of the few countries in the Middle East to realize the importance of coping with the new trends of change occurring in the world It is the first Arab country to join the ... corporate information with stakeholders or with other interested parties (Barko, Hancock & Izan, 2006) These financial reports include information that may help in recognizing the financial position ... the quality of investment decisions based on information contained in the financial report Improving the high level of disclosure information is positively thought to affect the investors’ confidence...

Ngày tải lên: 06/01/2015, 19:46

8 468 0
A study on the use of listening test-taking strategies and their relationship with students' performance at Que Vo I Upper Secondary School in Bacninh

A study on the use of listening test-taking strategies and their relationship with students' performance at Que Vo I Upper Secondary School in Bacninh

... of the study The study aims to reach the following targets: -Studying the listening strategies used by students when taking a listening test: the frequency and vary in listening proficiency in ... overall meaning of the text, relating the background knowledge with the information in the text, understanding the meaning of each word, focusing on the details, and mentally sounding out the words ... is divided into stages: pre-listening, while-listening and post-listening in order to obtain certain language comprehension or skills II.1.1.2.1 Stages of teaching listening Listening lessons...

Ngày tải lên: 19/03/2015, 10:33

69 618 0
A study on the use of listening test-taking strategies and their relationship with students' performance at Que Vo I Upper Secondary School in Bac ninh

A study on the use of listening test-taking strategies and their relationship with students' performance at Que Vo I Upper Secondary School in Bac ninh

... teaching listening ……………………… II.1.1.2.2 Listening skills, tasks and activities……………………… v II.1.2 .The context of teaching and learning listening skill at upper-secondary school II.1.2.1 .In Vietnam ... Listening strategies…………………………………………………… 1.2 Listening test/task……………………………………………………… Listening Strategies in Second Language Learning Listening Task in Relation to Task Performance and Strategy ... II.1 .The setting of the study………………………………………………… II.1.1.Overview of the new “Tiếng Anh 12” textbook………………………… II.1.1.1.General description……………………………………………… II.1.1.2.Listening skill in the textbook………………………………….…...

Ngày tải lên: 19/03/2015, 10:36

3 495 0
A study on the use of listening test-taking strategies and their relationship with students' performance at Que Vo I Upper Secondary School in Bacninh

A study on the use of listening test-taking strategies and their relationship with students' performance at Que Vo I Upper Secondary School in Bacninh

... of the study The study aims to reach the following targets: -Studying the listening strategies used by students when taking a listening test: the frequency and vary in listening proficiency in ... tasks or listening tests is the strategies they use Therefore, my minor thesis here studies the use of listening test-taking strategies and their relationship with Students’ performance 2 .The aims ... to listening and believe it to be an important skill in teaching and learning For instance, Nunan (1998) believes that: “… listening is the basic skill in language learning Without listening...

Ngày tải lên: 10/08/2015, 19:48

12 487 2
Unit 12 _ The Aían Games_ Listening

Unit 12 _ The Aían Games_ Listening

... in the report?  High Jump How was Vichai after he finished his performance?  Disappointed  Name:  Age: 44  Name  Lý Đức of sport: bodybuilding Records: + The 4th at World Bodybuilding in ... mentioned in the report? A swimming B gymnastics C long and high jumps D weightlifting Yuko won the gold medal in women’s swimming She set a new world record time of _ A 200 seconds B minute ... D weightlifting How many gold medals have the Japanese athletes won in the first three days?  Six How many times has Lee Bong-Ju competed in the long jump?  Two times What was the last sports...

Ngày tải lên: 26/07/2013, 01:25

10 310 1
Skills for the TOEIC test listening and reading

Skills for the TOEIC test listening and reading

... building The trees are _ 12 the the building LISTENING PAKI 1:PM UIUS The flowers are The pen is the vase the book The computer monitor is desk the COMMON DISTRACTER TYPES In Part of the Listening ... your skills in a specific area, listening and reading or speaking and writing Listening and Reading The TOEIC Listening and Reading Test takes approximately 2.5 hours to complete • Listening Section ... 15 SKILLS FOR THE TOEIC® TEST: LISTENING AND READING TASK Listen to each statement Circle the word that you hear thinking drinking pile aisle train plane warning warming meeting eating package...

Ngày tải lên: 15/08/2013, 13:56

256 2,6K 0
The Teaching of Listening

The Teaching of Listening

... divide listening for comprehension into three stages; Listening and making no response (following a written text, informal teacher talk) Listening and making short responses (obeying instructions ... clear lead in what they are going to hear; use some kind of visual back up for them to understand; give questions and tasks in order to clarify the things in their minds; and be sure that these tasks ... certain that listening experiences will become more productive? Wittich tells us to distinguish the four levels existing in listening to radio or recordings: • • • • Level This mood is listening...

Ngày tải lên: 06/09/2013, 10:10

8 489 1
Designing listening tasks using authentic materials on websites as supplementary materials for the teaching of listening skills

Designing listening tasks using authentic materials on websites as supplementary materials for the teaching of listening skills

... differences in sounds • Listening for specific information • Listening for organizing ideas • Listening for main points • Listening for varied points of view • Critical listening • Creative listening ... understanding such as to whom they are listening, what they are going to listen and why they are listening Therefore, teachers of listening should always bear in mind this characteristic so that they ... categorized listening into three types: • Appreciational listening (enjoying the development of s story; listening for pleasing rhythm; reacting to the mood set by the author) • Informational listening...

Ngày tải lên: 07/09/2013, 13:37

36 1K 5
THE ART OF LISTENING

THE ART OF LISTENING

... lắng nghe họ The higher they are in the decision hierarchy, the more input of information and knowledge is required, and hence, the more the decision-maker must develop his listening ability Họ ... Effective listening skills would have enabled the CEO to build and sustain trust with the staff, seek out different points of view and deepen his insight into the company – all of which would have then ... Leadership Means Listening in the Jan 13 issue of Business Week, said that one theme that regularly came up in her interviews with business leaders was that “great leaders are great listeners” Nhà...

Ngày tải lên: 26/09/2013, 04:10

6 401 0
w