... cross-peaks attributed to bH of Ala12 and NH of Val15, and aH of Pro13 and NH of Val15 Ó FEBS 2004 Structural study of internal fusion peptide of ASLV (Eur J Biochem 271) 4733 Conformational alteration ... nm at a scanning rate of 50 nmÆmin)1 with a time constant of s, step resolution of 0.1 nm, and bandwidth of nm The final spectra were taken from the average of five scans The VARSELEC program was ... the membrane bilayer Self -assembly can also be analyzed by compositional variation of rhodamine-labelled peptide, keeping the total concentration of labelled and unlabelled peptides constant...
... from the attached cells according to Bligh and Dyer [20] After lipid extraction the aqueous and organic phases were separated and the radioactivity of each phase was measured Incorporation was determined ... absence of HePC The results indicate that the APC did not affect the rate of intracellular PC degradation as the radioactive label of PC was similar in both control and HePC-treated cells and neither ... Cytidylyltransferase (CT) activity was assayed both in the cytosolic supernatant and the particulate pellet Data are expressed as percentages of distribution of cytosolic or membrane- bound CT activities...
... spectra of 2.0 · 10)3 M agmatine before (A) and after (B) oxidation catalyzed by P sativum copper amine oxidase, at pD 7.4 and 25.0 °C Acquisition parameters: scans, flip angle 45°, relaxation delay ... polarographic) The stoichiometric analysis of the enzymatic oxidation of agmatine yields a molar ratio of substrate (i.e agmatine) to O2 and H2O2 of : : Figure shows the 1H-NMR spectra of agmatine ... (Paris, France) All the other chemicals were from Merck AG (Darmstadt, Germany) All products were of analytical or reagent grade and used without further purification Animals Male Sprague–Dawley rats...
... General Information Meeting 64th OB-GYN Assemblyof Southern California Dates Friday, April and Saturday, April 4, 2009 Venue Marriott Marina del Rey Los Angeles-Marina del Rey, California Main ... pregnancies; Recognize the role of medication in the management of cardiovascular diseases during pregnancy; Understand the limitations of the management of diabetes in pregnancy; and Explain ... California Faculty Ricardo Azziz, M.D., M.P.H, M.B .A Chair, Department of Obstetrics and Gynecology Cedars-Sinai Medical Center Professor and Vice-Chair, Dept of Obstetrics and Gynecology, and...
... SP Jiangsu Fujian Hongkong USA Netherlands USA USA USA USA USA USA Canada Canada Thailand Thailand Denmark Denmark Korea Korea Japan Japan Vaccine Vaccine Vaccine Vaccine 2006 2005 1999 1990 1991 ... Netherlands USA USA USA USA USA USA Korea Korea Canada Canada Russia Russia Thailand Thailand Denmark Denmark Belarus Spain Philippines Mexico Vaccine Vaccine Vaccine Vaccine 2004 2007 2007 1990 ... Hebei Hebei Shandong Shandong Jiangsu Jiangsu Anhui Zhejiang Zhejiang Zhejiang Gansu Fujian Hunan Hubei Guangdong Guizhou Chongqing Sichuan Sichuan Yunnan Shanxi Hainan Shanghai Taiwan 2008 1996...
... Mesoscopic assemblies and Packing parameter representation (Redraw from Nature Materials 2005, 4, 729)53b Satyananda Barik National University of Singapore a) Micelles: The foundation of today’s bottom-up ... fabricating materials with size ranging from micro to nanoscale The most intriguing feature of this approach is the Satyananda Barik National University of Singapore molecular level to nanoscale ... representations of bilayer supramolecular assemblies; micelles (a) , vesicles (b) and lamellae (c) Figure 1.3 Schematic representations of supramolecular columnar stacking (a) , helical (b) and tubular (c) assemblies;...
... height images of AUSSBT nanoparticles 140 6.4 (A) TEM and (B) AFM height images of AURSBT nanoparticles 141 6.5 (A) TEM and (B) AFM height images of AU5SBT nanoparticles 142 6.6 (A) TEM and (B) AFM ... technological applications of advanced materials [142] and more mature applications like catalysis [143] 1.7.2 Band Structure of Noble Metal Nanoparticles Metal nanoparticles are in the gray domain ... is that ¯lms can be obtained with common solvents on various substrates Another class of materials, alkanethiolsstabilized metal nanoparticles, display electronic, optical and structural features...
... elongation of unsaturated fatty acids, anda knockout might result in overproduction of saturated fatty acids and reduced production of unsaturated fatty acids by FabA, leading to the lethality of ... FabD, FabH_2, FabB_3, and AccACD In this cycle, acetyl-CoA is carboxylated (driven by ATP hydrolysis) and decarboxylated again (Fig 2) The remaining EFMs are capable of producing all of the main ... oflipidA comprise 24 EFMs in the case oflipidAand 51 for lipidA (ca) In addition, there are a number of side EFMs forming lipidA [or lipidA (ca)] and, simultaneously, other products of...
... adipophilin was purified from milk and its cDNA was isolated from a mammary gland clone collection [57], while human mammary gland and mammary adenocarcinoma ESTs similar to PP17b cDNA was found by BLAST, ... strategies employing MS or MS/MS and database searching Anal Chem 71, 2871–2882 25 Harima, Y., Nagata, K., Harima, K., Oka, A. , Ostapenko, V.V., Shikata, N., Ohnishi, T & Tanaka, Y (2000) Bax and ... PAX-2 [49]; (h) factors abundant in placenta, AHR [50], AP-2 and PPARc; (i) proliferation and/ or apoptosis regulators, AP-2, c-MYC [51] and NF-jB; (j) embryo- and organogenic factors, PAX-2 and...
... cDNA coding for human p2 5a and primers 5¢-CACTCTAGACCATGGCTGCATCCCCTGAGCTCAGT-3¢ and 5¢-CACGGATCCCTACTTGCCCCCTTGCAC-3¢ for P25aDN, and 5¢-CACTCTAGACCATGGCTGACAAGG-3¢ and 5¢-CACGGATCCCTACGTCACCCCTGA-3¢ ... 44–156, was amplified and tagged with six histidine residues by PCR using forward primers 5¢-CACCATCACGGAGCATCCCCTGAG3¢, 5¢-TCGCATCACCATCACCATCACGGAGCA-3¢ and 5¢-CACCCATGGGATCGCATCACCAT-3¢, and reverse ... Localization of DAT and p2 5a transiently expressed in SH-SY5Y cells was analyzed by confocal laser scanning microscopy A representative cell is shown with granular andmembrane staining of DAT and...
... PAGE analysis of the mitochondrial membranes isolated from all these deletion strains and from a wild-type strain In the DQCR9, DISP and DBCS1 strains, a protein band of approximately 500 kDa ... molecular mass calibration markers included thyroglobulin (670 kDa), apoferritin (440 kDa), catalase (230 kDa), alcohol dehydrogenase (150 kDa), conalbumin (78 kDa), albumin (66 kDa), and b-lactoglobulin ... ~230 kDa BN-PAGE B ~500 kDa A WT Fig Resolution of mitochondrial membranes from wild-type (WT) and DQCR10 yeast strains by BN ⁄ PAGE and SDS ⁄ PAGE (A) Mitochondrial membranes were analyzed by...
... amplified as template with primer set VgRi-f4 (5¢-TAATACGACT CACTATAGGGCGTGATCAGGTCAAAACGTATTTTC TTCATTT-3¢) and VgRi-r3 (5¢-TAATACGACTCACTATA GGGGCCACAGTCATCCTTTTTATCGCATACTAC-3¢) for dsRNA synthesis ... 648–878) using primer set VgRi-f1 (5¢-TAATACGACTCACTATA GGGGCCATCTGCAATTATCAACGCCTTTCTTAACG TC-3¢) and VgRi-r1 (5¢-TAATACGACTCACTATAGGG ACCACATACTGTGCATCGCGTGAATAAGGTGTC-3¢), which included the T7 ... ovaries (A) Membrane protein from the ovaries of virgin queens (lanes and 3; protein from 16 pairs of ovaries) and mated queens (lanes and 4; protein from four pairs of ovaries) was analyzed by...
... proteins Arrows indicate the direction of transcription genomic DNA using forward (5¢-GGAGGGATCCCATATG AAGTCTAAATTTAAATTAACG-3¢) and reverse (5¢-GC primers GTGCTCGAGCGATCCATGGAGCCGTA-3¢) that incorporated ... genes aauD and aauE are similar to mauD and mauE, respectively, from the methylamine utilization (mau) gene cluster, and the latter two genes are essential for MADH biosynthesis [13] Like mauE, aauE ... Growth of cells and media The bacterial strains and plasmids used in this study are listed in Table For strain stocks and DNA isolation, E coli andA faecalis were cultured with Luria–Bertani media...
... mL of MTE and re-isolated by centrifugation as Mitochondrial membranes were analyzed by standard SDS/PAGE with 15% (w/v) acrylamide and an acrylamide/bis-acrylamide ratio of 30 : 0.8 (w/w) [25] ... helix that spans the membrane parallel to cytochrome b, interacting extensively with transmembrane helices G and H1 and also interacting with helix aof cytochrome b parallel to the inner membrane ... yeast mutant lacking mitochondrial DNA anda yeast mutant with a truncated cytochrome b gene The wild-type (WT), q°, and CKL57 yeast strains were grown on YPD medium and mitochondrial membranes...
... The presently available data suggest that Cyanobacteria, Bacillales and Lactobacillales with the exception of B halodurans, Geobacillus stearothermophilus and Pasteuria nishizawae use exclusively ... 043 of the B subtilis chromosome was amplified by PCR using chromosomal B subtilis DNA as template and the oligonucleotides 5¢-TTGGTGGGATCCGTGACTCG AGCAGAACGAAAAAGAC-3¢ and 5¢-GGCTTTGTCG ACTTATCGCACACTATAGCTTGATG-3¢ ... grouping of 76 type II isomerases in the archaeal and eubacterial kingdoms as illustrated in Fig Bacillales and Lactobacillales form a cluster which is separated from other lineages with statistical...
... were as follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies ... fraction is designated as the mitochondrial fraction Immunochemical assays and antibodies Mitochondrial protein samples (between 50 and 100 lg) were separated by SDS/PAGE and BN/PAGE and transferred ... assemblyof an active mammalian mitochondrial complex I Experimental procedures Cell lines and cell culture The isolation and preliminary biochemical and genetic characterization ofa series of respiration-deficient...
... Spirochaeta aurantia LGLB are either branched or unsaturated Values stated are the average nmolÆmg)1 with standard deviations (±) obtained from quantifying and averaging areas under specific peaks ... Spirochaeta aurantia, a pigmented, facultatively anaerobic spirochete J Bacteriol 97, 386–395 Breznak, J .A & Canale-Parola, E (1975) Morphology and physiology of Spirochaeta aurantia strains isolated ... B, a- Fuc3N P, a- Fuc3N (1) C, a- Glc (2) D, a- GalA E, a- GalA6Asp F, a- GalA G, a- GlcA (1) G, a- GlcA (2) I, a- GalNAcA K, b-GlcA 13 C L, b-GlcA (1) 13 C L, b-GlcA (2) M, b-Xyl N, b-Gal O, b-Xyl Asp...
... respective tags (anti-HA or anti-T7) and analysed by SDS/PAGE, and the bands were visualized on a phosphorimager The translocation of KdpD-N was not affected by the depletion of SecE (Fig 5A) , whereas ... epitopes can provide valuable data for the analysis of how specific regions ofamembrane protein are translocated across the membrane The analysis of the translocation requirements showed that the ... the appearance of the C-terminal fragment (lanes and 5) As a control, the accumulation of M13 procoat protein was analysed in a parallel culture (Fig 1D, upper panel) The results show that under...
... NA hp0547 Cagf ⁄ Cag1 Cage ⁄ Cag2 Cagd ⁄ Cag3 Cagc ⁄ Cag4 Cagb ⁄ Cag5 Caga ⁄ VirB11 CagZ CagY CagX CagW CagV CagU CagT CagS CagQ CagP CagM CagN CagL CagI CagH CagG CagF CagE CagD CagC CagB CagA ... inversion of cagQ, a duplication of cagA and cagB associated with cagA degeneration, anda more complex rearrangement comprising all cag genes except cagA anda second inversion of several flanking genes ... projects have revealed certain variations of the general gene arrangement For example, some strains isolated from American Indians have a duplication of cagA (in a nonfunctional form) and cagB inserted...