... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... membranes Anti-HA and anti-porin sera were used at : 5000 dilution whereas the anti-MWFE and anti-18 kDa sera were used at : 1000 dilution Horseradish peroxidase-conjugated secondary antibodies (anti-rabbit ... assembly of an active mammalian mitochondrial complex I Experimental procedures Cell lines and cell culture The isolation and preliminary biochemical and genetic characterization ofa series of respiration-deficient...
... (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template To facilitate purification of recombinant enzyme, ... the C acidovorans plasmid was established using the AlkPhos Fig Location of the xdhAB gene operon on an isolated Comamonas acidovorans plasmid Agarose gel (A) and Southern blot (B) analyses of 0.3 ... The level of functional enzyme refers to XDH species containing a functional Mo catalytic center The functionality is estimated as a ratio of change in the absorbance at 450 nm after anaerobic...
... blot analysis of cytosolic sample probed with anti-(rat liver DPP III) that allowed the detection of both bands at 82 and 86 kDa anchorage of D melanogaster DPP III By comparison, the analysis of ... (Matsumoto Dental University, Nagano, Japan) The anti-(rat liver DPP III) was prepared as described by Fukasawa et al [2] Goat anti-rabbit Ig with peroxidase labelling was from Boehringer-Mannheim The ... SDS/PAGE analysis of fractions containing partially purified DPP activitiy revealed two major bands in the range of 82 and 86 kDa in both cytosolic and membrane samples (Fig 5) Western blot analysis...
... equation and a Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability of approximately additive mappings J Math Anal Appl ... pnas.27.4.222 Bae, J-H, Park, W-G: On stability ofa functional equation with n variables Nonlinear Anal TMA 64, 856–868 (2006) doi:10.1016/j.na.2005.06.028 Bae, J-H, Park, W-G: On a cubic equation ... Bae and Park Journal of Inequalities and Applications 2011, 2011:82 http://www.journalofinequalitiesandapplications.com/content/2011/1/82 Page of for all x, y, z, w Î X Thus, the mapping F satisfies...
... (2002) Kenary, HA: The probabilistic stability ofa Pexiderial functional equation in random normed spaces Rend Del Circolo Math Di Palermo (to appear) Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, ... details Department of Mathematics, College of Sciences, Yasouj University, Yasouj 75914-353, Iran 2Department of Mathematics, University of Ulsan, Ulsan 680-749, Korea 3Department of Mathematics, ... |r| + |s| A field K is called a valued field if K carries a valuation The usual absolute values of ℝ and ℂ are examples of valuations In 1897, Hensel [14] has introduced a normed space which...
... Analysis, Cambridge Mathematical Library, Cambridge University Press, Cambridge, UK, 1996 B.-N Guo and F Qi, “Inequalities and monotonicity for the ratio of gamma functions,” Taiwanese Journal ... Differential- und Integralrechnung II, VEB Deutscher Verlag der Wissenschaften, Berlin, Germany, 1966 M Abramowitz and I A Stegun, Handbook of Mathematical Functions with Formulas, Graphs, and Mathematical ... inequality,” Tamkang Journal of Mathematics, vol 31, no 2, pp 145–148, 2000 F Qi and J.-S Sun, A mononotonicity result ofafunction involving the gamma function, ” Analysis Mathematica, vol 32,...
... “Approximate homomorphisms,” Aequationes Mathematicae, vol 44, no 2-3, pp 125–153, 1992 11 Th M Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, ... Differential Equations and Their Applications, Birkh¨ user, Boston, Mass, USA, 1998 a S.-M Jung, Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, ... point approach to the stability of an equation of the square spiral,” Banach Journal of Mathematical Analysis, vol 1, no 2, pp 148–153, 2007 14 S.-M Jung and J M Rassias, “Stability of general Newton...
... Isac, and Th M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear Differential Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, ... Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics and Its Applications, Cambridge University Press, Cambridge, ... Journal of Inequalities and Applications Banach algebra Ꮽ They have shown that if a mapping f : X → Ꮽ satisfies f (x ◦ y) − f (x) f (y) ≤ (3) with some > 0, then there exist a commutative C ∗ -algebra...
... both Tax1 and Tax2, but amino acids 90 to 100 are also critical for the localization of the viral transactivators [16] Using prediction software as well as in vitro assays, we now describe another ... export via the CRM1 pathway, and that point mutations at positions 195 and 200 abrogate NES mediated translocation All in all, these results demonstrate that the NES sequences of Tax1 and Tax2 have ... using a Zeiss Axiocam HRc (color) camera and the Zeiss Apotome software Images of cells that are representative of the entire population are shown (C and E): Western-blot analysis of GFP and GFP-NES...
... Hirakawa, H., Ohshima, K., Yamashita, A. , Shiba, T., Ogasawara, N., Hattori, M., Kuhara, S., and Hayashi, H (2002) Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater ... Rubie, E A. , Ahmad, M F., Avruch, J., and Woodgett, J R (1994) The stress-activated protein kinase subfamily of c-Jun kinases Nature 369, 156-160 Lachumanan, R., Armugam, A. , Durairaj, P., Gopalakrishnakone, ... Kotiranta, A. , Lounatmaa, K., Kari, E., Kerusuo, E., and Haapasalo, M (1997) Functionof the Slayer of some Gram-positive bacteria in phagocytosis FEMS Microbiol Rev 20, 110-114 Krivan, H C., Clark,...
... 5. 5A) ; the cleavage of NAD by H-bond formation of the nicotinamide carboxyamide and the amide (NO1) and carbonyl group of Arg296 with the NN7 if nicotinamide followed by spontaneous withdrawal of ... components of signal transduction pathways, is a promising pharmacologic agent that can be utilized for physiological research at the cellular to organ level It may also be tapped as an anti-tumor drug ... ligand in colonic lysate whose influence was dissipated at higher ABP concentration To test our hypothesis, analytical grade muscle actin was used as substrate in photolabeling assay αactinin and...
... drawing of SN1-type mechanism for Ia 130 x List of Abbreviations AAD antibiotic-associated diarrhea ADP adenosine diphosphate ATP adenosine triphosphate ADPRT ADP-ribosyltransferase ARTase ... ADP-ribosyltransferase assay (ARTase), analyses of wild-type and mutant CDTa activities revealed conserved amino acid residues that are crucial for its ability to hydrolyze cofactor nicotinamide adenine ... way to help Allow me to also extend a heartfelt gratitude to my labmates who have made my stay bearable, particularly to Gan Bong Hwa whom I have learned to consider as my little sister primarily...
... Re-examine some of the most important issues related to the experiential aspect of functional grammar Analyze the meaning and structure ofa narrative based on the systemic functional analysis ... the syntactic structure of language, it prefers placing the functionof language as central (what language does and how language does it) rather than placing the elements of language and their ... grammar are different from formal models of grammar by their focus on the communicative aspect of language 2.4 Metafunctions Halliday developed a theory of the fundamental functions of language...
... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ability/neg ... relational was III Senser mental see Existent relational were Actor material descended Actor material landed Actor material put on Goal Actor material opened Goal Actor material climbed 10 Actor material...
... ethnic background of at least 1000 subjects was typical of the American Midwest with 90% of European ancestry and 5% each of African and Asian ancestry An exception was the targeted analysis of ... sum of peaks of ApoC1 was determined for fraction and assigned a value of 1.0 The peak ratios in subsequent fractions are expressed relative to that value Also shown are the relative ratios of ... variants of ApoC1 A functional importance ofa methyl group side chain at position 45 was also suggested by homology alignment ApoC1 from six available species shows either Ala or Thr at the comparable...
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... standards (Amersham-Pharmacia Biotech or BioÁRad) DNA fragments of appropriate length were ligated into the T /A vector, pCRII (Invitrogen, San Diego, CA, USA), using T4 DNA ligase overnight at...