bereavement after the death of a therapist

... Paula, about six months after she died in a car accident The dream began in a huge, dark room, but I was not scared At the far end of the room, I saw soft, beautiful white light and Paula floating ... Less common than the other types of grief dreams, the trauma dream often comes in the form of a flashback, especially in early grief and particularly in cases of traumatic deaths, such as murders, ... personalities, whether or not others are around to offer us support, and the nature of the relationship we shared with the deceased Anticipated or Unanticipated Death Often the cause of death determines...

Ngày tải lên: 29/03/2014, 04:20

Ngày tải lên: 21/03/2014, 22:04

... Environmental Medicine 1997, 39(11):1111-1114 30 Shibata A, Oka K, Nakamura Y, Muraoka I: Recommended level of physical activity and health-related quality of life among Japanese adults Health and quality ... survey All authors read and approved the final manuscript Acknowledgements This study was supported by a Grant-in-Aid for Scientific Research from the Ministry of Health, Labor, and Welfare of Japan ... generated by the linear regression analyses The results of the univariable and multivariable analyses were quite similar All of the category scores, but for RP among passive smokers, increased...

Ngày tải lên: 20/06/2014, 16:20

... Environmental Medicine 1997, 39(11):1111-1114 30 Shibata A, Oka K, Nakamura Y, Muraoka I: Recommended level of physical activity and health-related quality of life among Japanese adults Health and quality ... survey All authors read and approved the final manuscript Acknowledgements This study was supported by a Grant-in-Aid for Scientific Research from the Ministry of Health, Labor, and Welfare of Japan ... generated by the linear regression analyses The results of the univariable and multivariable analyses were quite similar All of the category scores, but for RP among passive smokers, increased...

Ngày tải lên: 12/08/2014, 01:21

Ngày tải lên: 21/03/2014, 22:01

... direct, and inform an individual to make the best use of the tools available, just as a stack of boards, nails, and a hammer don’t make a house — it takes the skilled craftsmanship of a carpenter ... of programs available for Linux, its uses can range from a single task as a monitor, to uses as a workstation for calculating advanced mathematical formulas or graphics You can use Linux as an ... format used by the Debian package-management system; for these you will learn other installation methods Although many of the applications covered here are available on the book’s CD, others are...

Ngày tải lên: 01/06/2014, 00:39

... increased the total area of luteal tissue that was generated as a result of the formation of an accessory CL However, these changes did not improve the pregnancy rate in Japanese black cows 278 Abdurraouf ... Abdurraouf Omar Gaja et al Acknowledgments We are grateful to the staff of the IRIKI farm of Kagoshima University and the students at the theriogenology laboratory of Kagoshima University for their ... 3, there is a positive correlation between the cross-sectional area of the DF one day before ovulation and the cross-sectional area of luteal tissue on day 12 The DF of each group has been classified...

Ngày tải lên: 07/08/2014, 20:24

... significantly different Table III Summarised results of two-way ANOVA testing the effect of year and treatment on anatomical parameters Year and treatment were taken as main factors Palisade parenchyma* ... nested within year Anatomical data were analysed with a factorial ANOVA taking year and treatment as main factors When main factors were significant, a Duncan test (P < 0.05) was used to test ... in six random fields per sample using a calibrated grid in 1999 A nested analysis of variance was applied to the study of specific leaf mass with year and treatment as main factors and date nested...

Ngày tải lên: 08/08/2014, 14:20

... IL-6[GenBank:16193] sense: 5’CACAGAAGGAGTGGCTAAGGACCA3’ antisense: 5’ACGCACTAGGTTTGCCGAGTAGA3’ 103 bp IL-17[GenBank:16171] sense: 5’GTCAATGCGGAGGGAAAG3’ antisense: 5’CACGAAGCAGTTTGGGAC 3’ 349 bp TNF -a ... the grants from the National Natural Science Foundation of China (No 30960129) We thank Dr Lan Jiao, Liang Zoujiu, Huang Qiguang for technical assistances Author details Guangxi Cardiovascular ... GenBank:21926] sense: 5’CACTGGAGCCTCGAATGTC3’ antisense: 5’CAGGGAAGAATCTGGAAAGGT3’ 128 bp b-actin [GenBank:11461] sense: 5’CCAGCCTTCCTTCTTGGGTAT3’ antisense: 5’TTGGCATAGAGGTCTTTACGG 3’ 102 bp Fan...

Ngày tải lên: 11/08/2014, 21:21

... Coleman TG, Meck JV: Development of the Digital Astronaut Program for the Analysis of the Mechanisms of Physiologic Adaptation to Microgravity: Validation of the Cardiovascular System Module Acta ... simulation of a man, the simulation of the woman upon reentry is unable to compensate for the factor initiating the initial drop in pressure Advanced analysis of the simulation history reveals that there ... only a variance in their longitudinal center of gravity Computer Systems Analysis of the Hypothesis The hypothesis was examined through a systems analysis approach using a derivative of a well-established...

Ngày tải lên: 13/08/2014, 16:20

... (Modular SWA) was also used for analyses of alanin amino-transferase (ALT), gammaglutamyl transferase (GGT), and bilirubin to assess liver function and of urea, creatinine, and glomerular filtration ... lymphoma (8%) Hodgkin disease (4%) Age at ATG treatment, years Mean (minimum, maximum) Statistical analysis The plasma concentrations of biochemical markers are reported as mean ± standard deviation ... underlying disease The ATG dose was selected according to donor-patient matching A test dose of ATG (20 mg) was given after the baseline (BL) samples were obtained on day Afterwards, ATG was administered...

Ngày tải lên: 13/08/2014, 16:20

... for a difference of at least 0.05 unit PRBC/patient/day with a standard deviation of 0.15 units PRBC/patient/day Statistical analysis We expressed variables as means ± standard deviations and ... intensivist) is a consultant in the division of respiratory and critical care medicine of the author's hospital LTK is the head of the division of respiratory and critical care medicine of the author's ... critical care of the author's hospital DP is a research assistant CYH is the head of the biostatistics unit of the Yong Loo Lin School of Medicine, National University of Singapore JP (medical intensivist)...

Ngày tải lên: 13/08/2014, 20:21

... graveyards of Egypt, so Anubis was linked to the dead He was the god of embalming and guardian of the dead After the dead man had been questioned, Anubis weighed his heart against the feather of ... El-Amarna Akhenaten built a new capital city, called Akhetaten, at the site now known as El-Amarna The city once had palaces, a temple to the Aten, and houses for the nobles, but it was abandoned ... to Cairo Workers pushed the wagons along the tracks Laying the tracks There was only a small amount of track, so it had to be taken up and laid again in front of the wagons Mace and Lucas at work...

Ngày tải lên: 14/11/2014, 08:59

... dirty pages • Data manager floods the cache This is rather similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious ... for another thread in that task • Server tasks which cannot tolerate changing data, or which must ensure that all of the necessary data is available, may use a separate thread to copy that data ... copied) data in a message • Data manager backs its own data Deadlock may occur if a data manager becomes blocked in a page fault waiting for data which it provides Fortunately, there are several techniques...

Ngày tải lên: 12/09/2012, 15:05

... – Advantages • Can carry up to three times the amount of data as TDMA • Transmissions are much harder to eavesdrop on • A would-be eavesdropper must also know the exact chip in which the transmission ... data to be sent – Imprints a unique address on the data – The longer the code is, the more users will be able to share the same channel – Number of chips in the code • Determines the amount of ... Divides the transmission time into several slots – Each user is assigned the entire frequency for the transmission • For a fraction of time on a fixed, rotating basis – Advantages • Uses the bandwidth...

Ngày tải lên: 13/09/2012, 10:52

... languages belonged to a third, Nilo-Saharan family, which may have originated in the broad Saharan region at least as early as Afroasiatic Nilo-Saharan may be distantly related to the fourth family, ... taken Carthage a decade later, and extended their power across the region sub-saharan africa Whether Carthage transmitted metalworking to sub-Saharan Africa is one of the mysteries of African ... within the Old World Thereafter sub-Saharan Africa occupied a unique position of partial isolation It was more isolated than Eurasian fringes like Scandinavia or South-East Asia, which gradually adopted...

Ngày tải lên: 21/09/2012, 10:39

... (not, reversal) ex- (out of, former) pre- (before) re- (again, restore) un- (do the opposite of) ad- (to, toward) com-, con-, co- (with, together) en-, em- (in, into, to cover or contain) in- (into, ... (with, together) en-, em- (in, into, to cover or contain) in- (into, not) pro- (in favor of, before) sub- (under, beneath) ...

Ngày tải lên: 02/10/2012, 12:07

... non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods Results Hospital setting and antibiotic ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International ... decreased and the trend of resistance rates became downwards after implementation of NARP The amount of money saved increased further After two years of NARP 5,389,155.82 USD saving occurred in the...

Ngày tải lên: 25/10/2012, 11:00