behaviors and attitudes of a trustworthy leader

... of death as a reality and as an escape than younger participants In that study, females were also significantly more accepting of life after death and more accepting of death as an escape than ... indicating acceptable inter-rater agreement and thus acceptable face validity Main sample Scale characteristics and reliability The means and standard deviations of the five factors were similar ... Palliative Care and Palliative Care Education Jonas Jansen Doctoral candidate, responsible for research project Andrea Schmitz Medical expert for Palliative Care and Palliative Care Education Manuela Respondek

Ngày tải lên: 10/01/2020, 14:08

... Syarif Hidayatullah State Islamic University Jakarta B., S (December 2019) Benefits of Web-Based Learning Test Engineering and Management Bambang Hariadi, M D (March 2016) Development of Web-Based ... Advisor: Mr Pham Nhu Luan (PhD), a lecturer of Faculty of Foreign Languages at Banking Academy of Vietnam Abstract: Web-based learning has piqued the interest of educators in recent years due to ... the features of Wordwall.net Code Questions Mean Standard Interpretation deviation B1 Teachers can create both interactive and 3.76 930 Agree 3.76 889 Agree of 3.61 738 Agree Teachers can easily

Ngày tải lên: 04/01/2024, 21:13

... registration, location, and acti- vation; request demultiplexing; framing and error-handling; parameter marshalling and demarshalling; and operation dis- patching. Figure 1 illustrates the primary components ... has already guaranteed that its deadline will be met, based on the published parameters of each schedulable operation One advantage of our approach is that operation invocations only pay ... I/O via interrupts I/O Facade I/O Facade Event Channel 2: push (demarshaled data) Aircraft Sensors 3: push (demarshaled data) Suppliers Figure 5: Example Avionics Application with Event Chan- nel Facades

Ngày tải lên: 19/02/2014, 18:20

... with an apparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B1). Table 1. N-Terminal sequences of the polypeptides of the purified enzyme. N-Terminal sequen ... of AF499 was identified as an archaeal promoter element by seque nce analysis. The sequ ence AAAGGTTAATATA shows a high le vel of identity with th e consensus se quence ()35 to )23, AAANNN TTATATA) ... with g values at 2.031, 1.994, and 1.951. The resonance started to develop at potentials ‡ 0 mV and was stable at potentials up to +350 mV. The loss and formation of the resonance was associated

Ngày tải lên: 21/02/2014, 03:20

... Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid Yang Chen, Ravi Kiran Koripella, Suparna Sanyal and Maria Selmer Department of Cell and Molecular ... 4714177 E-mail: maria.selmer@icm.uu.se Database The atomic coordinates and observed structure factors are available in the Protein Data Bank database under the accession number 2XEX (Received 22 April 2010, ... linker has flipped away to create the 40 A ˚ shift of domain IV relative to domain III Mutation to a larger side chain may change the relative positions of domain III and V [16] as well as the

Ngày tải lên: 06/03/2014, 22:21

... Proteobacteria, Gammaproteobacteria 1 1 Salmonella enterica ssp. I choloraesuis Proteobacteria, Gammaproteobacteria 0 2 Chromohalobacter salexigens DSM3034 Proteobacteria, Gammaproteobacteria 1 1 Acinetobacter ... Proteobacteria, Alphaproteobacteria 2 0 Dinoroseobacter shibae DFL 12 Proteobacteria, Alphaproteobacteria 2 0 Loktanella vestfoldensis SKA53 Proteobacteria, Alphaproteobacteria 2 0 Roseovarius ... shared secondary structure characteristics of transthyretins and TLPs are indi- cated above the alignment: motifs A? ??–C’ are indicated with straight lines and are labelled; b-strands are indicated

Ngày tải lên: 07/03/2014, 00:20

... was inhibited not only by unlabeled Bip-Pro itself, but also by well known sub- strates of H + ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic ... amount of Bip-Pro in the extracellular uptake medium was quantified according to the laboratory standard HPLC (La-Chrom Ò ; Merck-Hitachi, Darmstadt, Germany) with a diode array detector and a ... Gly-Gln, Ala- Ala, Ala-Ala-Ala, Lys-Lys, d-aminolevulinic acid, cefadroxil, Gly, Pro-Ala, 8-aminooctanoic acid and Gly-Sar were from Sigma-Aldrich (Deisenhofen, Germany). Tert. butyloxycar- bonyl (Boc)–Bip,

Ngày tải lên: 07/03/2014, 05:20

... Japan) and was manufactured to Japanese Safety Standard for domestic use in Japan; The original... LTA as Temporary Certificate of Entitlement, TCOE) Original identification document of ... profile printout of the Club/Association/Organisation or other certificate issued by the relevant regulating authority and original NRIC (Singaporean, Singapore PR and Malaysian) or Passport ... emission standard and above (for diesel-driven car); or c) Get your car tested and certified by any of LTA/NEA-recognised vehicle test laboratories (listed in Annex A) . The laboratories are required

Ngày tải lên: 07/03/2014, 11:20

... 5¢-CCGTAAGGTCACAGGTCACTCG-3¢, DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢, DR3: 5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGG TCACCAGGAGGTCACTCG-3¢ PAL0: 5¢-CGCAAGGT CATGACCTCG-3¢ ... 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose gel using Gel Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with 32P using a Metaprime ... procedures Parasites The NMRI strain of S mansoni was maintained in snails (Biomphalaria glabrata) and Syrian golden hamsters (Mesocricetus auratus) Cercariae were released from infec- FEBS Journal 274

Ngày tải lên: 07/03/2014, 11:20

... AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT ... (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new ... CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); for Ga15 (5¢-AT GGCCCGGTCCCTGACTTGG-3¢) and (5¢-TCACAGCA

Ngày tải lên: 07/03/2014, 16:20

... (5¢-GGCCAAGCTTCTAGAAC TTGAGAACCCTAGC-3¢) (for the P. horikoshii CoADR), and TG104 (5¢-CGCGCCATGGAAAAGAAAAAGGTA GTCATAA-3¢) and TG105 (5¢-CGCGGTCGACCTAGAA CTTCAAAACCCTGGC-3¢) for the P. furiosus CoADR. The ... act as an NADH oxidase in vivo, instead act- ing as a CoADR. This is only the second demonstra- ted CoA reductase activity, and the first appearance of this activity in both the Archaea and in a ... concentration (as determined at 460 nm). blast and tfasta analysis of the phCoADR revealed a significant level of identity to putative NADH oxidases from hyperthermophiles and bacterial NADH oxidases

Ngày tải lên: 07/03/2014, 17:20

... Phytophthora megasperma. This enzy- matic activity plays a fundamental role in the biosynthesis of methylated dianthramide-derivatives, the carnation phyto- alexins. However, no data are available regarding ... several plants, an accumulation of methylated flavonoids has been explained as a protection against pathogens, predators and ultraviolet radiation [2]. A recent investigation concerning the pathogenic ... compo- nents of each reaction mixture, after their chromatographic separation and purification, were submitted to 1 HNMR (nuclear magnetic resonance) and FABMS (fast atom bombardment mass spectrum) analyses

Ngày tải lên: 08/03/2014, 08:20

... bridge. Structural and functional characteristics of Ch-PRX1 The amino-acid sequence of Ch-Prx1 shares highest identity with the BAS1 protein of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and ... were separated by HPLC and some of them were totally or partially analyzed by Edman sequencing and/ or by MALDI-TOF mass spectrometry ( Fig. 2). Computer database searches based on the amino-acid sequences ... P., Rivera-Madrid, R., Marinho, P., Le Mare  chal, P., Miginiac-Maslow, M. & Meyer, Y. (1994) Arabidopsis thaliana NADPH thioredoxin reductase: cDNA characterization and expression of the

Ngày tải lên: 08/03/2014, 16:20

... xylosoxydans ssp xylosoxydans A- 6 N-acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl–D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax paradoxus ... D-Aminoacylase European Patent 60,950,706 ,A2 22 Kubo, K., Ishikara, T & Fukagawa, Y (1980) Deacetylation of PS-5, a new beta-lactam compound II Separation and purification of L-amino acid acylase ... N-D-AAase, was also produced in the Escherichia coli, purified and characterized MATERIALS AND METHODS Bacterial strains, plasmids and conditions Variovorax paradoxus Iso1 was isolated from an

Ngày tải lên: 08/03/2014, 16:20

... and understand as the text follows a certain kind of logical order among elements in a text and the organization of ideas is systematical and logical Cohesion and coherence are important skills ... Stage eight (Evaluation and teachers’ feedback): Students’ writings are evaluated and finally teachers give feedback As for paragraph writing, Wohl (1985) states that having a good writing, learners ... the advantages and disadvantages of CL, it is necessary for teacher to use this technique in English language classroom because CL brings a lot of benefits for learners Additionaly, drawbacks of...

Ngày tải lên: 02/07/2017, 17:41

... have been primarily in the areas of cost and capacity rather than performance There are two components of disk performance: transfer bandwidth and access time Although both of these factors are ... simulates the actions of a cleaner until a threshold number of clean segments is available again In each run the simulator was allowed to run until the write cost stabilized and all coldstart variance ... separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database system can...

Ngày tải lên: 12/09/2012, 15:05

... degrees, the peak rate of heat release is at 357 degree crank angle and on retarding by and degrees, the peak heat release rate is found at 362 and 363 degrees against 361 degree with standard timing ... development of biofuel, Planning commission, Government of India, 2003 S Jindal, B.P Nandwana, N.S Rathore Comparative evaluation of combustion, performance and emissions of Jatropha methyl ester and Karanj ... hydrocarbon (HC) and oxides of nitrogen (NOx) with exhaust gas opacity The software enables evaluation of performance from the acquired data using standard relationships The BTHE is evaluated...

Ngày tải lên: 05/09/2013, 16:11

... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets of ... Nelder and Mead A global analysis of Tables and reveals an important outcome: the method of Powell systematically leads to the smallest values of the objective function and of the number of simulator ... Holland J.H Adaptation in Natural and Artificial Systems The University of Michigan Press: Ann Arbor, 1975 Okamoto M., Nonaka T., Ochiai S., Tominaga D Nonlinear numerical optimization with use of...

Ngày tải lên: 05/09/2013, 16:30

... the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... the meaning and structure of “Torquay? But I said Turkey!” as a text The analysis is based on the framework of Halliday’s (1994)An Introduction to Functional Grammar, Halliday and 21 Hasan’s (1997) ... written channel - High lexical density and parataxis and low grammatical intricacy CHAPTER IV: CONCLUSION 4.1 Recapitulation The writing of “The meaning and structure of a narrative: a systemic...

Ngày tải lên: 07/09/2013, 13:48

... advantages are clearly explained Wildi also presents the two types of induction motors: “the squirrel cage induction motor” and the “wound motor” An explanation of the advantages and disadvantages ... Therefore, data acquisition, debugging and fault logging are realized ì fast A/ D (Analogue to Digital) converters with 10-bit resolution make the computation of accurate, real-time phase current measurements ... to generate a means of instantaneously controlling the torque and flux Field-orientated controllers require control of both magnitude and phase of the AC quantities and are, therefore, also referred...

Ngày tải lên: 27/10/2013, 23:15