be a useful abutment for a fixed prosthesis
Tài liệu A Sense of Wonder, aris rising from Aesthetic Experiences, should be the hould be the Starting Point for Inquiry in Primary Science ppt
Ngày tải lên :
19/02/2014, 17:20
... canonical abstract ideas, and place an emphasis on the nature of science and the way it operates” (p.31), identify the affective domain as an insight to a way forward for primary science educators ... and structure of nature Mathematical Appreciating the natural patterns of nature both in form as for beauty and abstraction for number Personal Enjoyment or pleasure Personal experiences, interest, ... processes they and others have used when generating and processing their data Summary As already stated, ‘creative exploration’ is an approach to teaching and learning that models many aspects of...
- 14
- 589
- 0
Be A Leader for God’s Sake -- From values to behaviors doc
Ngày tải lên :
07/03/2014, 19:20
... servant Be a Leader for God’s Sake leadership I believe his metaphor also applies to agapao leadership A Jazz band is an expression of servant leadership The leader of a jazz band has the beautiful ... something that made sense for a leader I examined the usage of agape and agapao in the New Testament and while agape seemed to refer to God’s love for us or for Jesus’ love for the Father, agapao seemed ... paradox of an agapao form of leadership, compared to an economic form of leadership, is that while the agapao leader concentrates less on the organization and more on individuals the organization...
- 199
- 458
- 0
Báo cáo khoa học: "A Bag of Useful Techniques for Efficient and Robust Parsing" ppt
Ngày tải lên :
08/03/2014, 06:20
... return false and no unification attempt will be made The conjunctive grammars have between 20 and 120 unary and binary rule schemata Since all rule schemata in our system bear a unique number, this ... ungrammatical, or spontaneous input, a traditional parser is not able to deliver a useful result To overcome this disadvantage, our approach focuses on partial analyses which are combined in a later ... is exactly these paths that are used later in filtering During parsing, when an active chart item (i.e., a rule schema or a partly instantiated rule schema) and a passive chart item (a lexical...
- 8
- 340
- 0
Fixed Deposit Accounts: Accounts that give you a fixed rate of interest for a defined term. potx
Ngày tải lên :
29/03/2014, 01:20
... sites Annual Equivalent Rate (AER) illustrates what the interest would be if interest was paid and compounded each year Our AER calculation assumes that the account is held for a year and that the ... Mortgage Saver / HeadStart / EasiSaver Accounts Not available for new applicants Available online All balances Instant Access Account e0.01 - e50,000 e50,000.01 + Gross*% 2.50 1.00 Regular Saver ... Gross Rate is the daily interest accrual rate AER (Annual Equivalent Rate) illustrates what the interest would be if interest was paid and compounded each year Our Annual Equivalent Rate (AER) calculation...
- 5
- 433
- 0
Báo cáo hóa học: " A fixed point theorem for Meir-Keeler contractions in ordered metric spaces" pot
Ngày tải lên :
20/06/2014, 22:20
... case cannot be obtained using a similar argument as in Theorem 2.3 because the proof that (xn) is a Cauchy sequence uses that xn-1 and xn + p are comparable and this can be false when T is a ... Bhaskar, T, Lakshmikantham, V: Fixed point theorems in partially ordered metric spaces and applications Nonlinear Anal 65, 1379–1393 (2006) doi:10.1016/j.na.2005.10.017 Harjani, J, Sadarangani, ... Sadarangani, K: Fixed point theorems for weakly contractive mappings in partially ordered sets Nonlinear Anal 71, 3403–3410 (2009) doi:10.1016/j.na.2009.01.240 Harjani, J, López, B, Sadarangani, K: Fixed...
- 8
- 403
- 0
Báo cáo hóa học: " Research Article VLSI Implementation of a Fixed-Complexity Soft-Output MIMO Detector for High-Speed Wireless" pptx
Ngày tải lên :
21/06/2014, 17:20
... LTE and WiMAX simulation chains and different channel models, several MIMO detection algorithms are applied to LTE and WiMAX systems and with their performance quantitatively evaluated Second, although ... Figures and shows that in case of 64QAM and the weakest (rate 0.926) channel coding defined in LTE is used, for × SM, the FER performance of MAP is always better than that of MFCSO and K-best MFCSO achieves ... eventually the log-likelihood ratio (LLR) Taking a 64QAM system as an example, as shown in the following: (8) which generates an upper triangular matrix Rk , and a unitary matrix Qk so that Hk...
- 13
- 270
- 0
Báo cáo hóa học: " Research Article A New One-Step Iterative Process for Common Fixed Points in Banach Spaces" ppt
Ngày tải lên :
22/06/2014, 03:20
... Xu and M A Noor, Fixed- point iterations for asymptotically nonexpansive mappings in Banach spaces,” Journal of Mathematical Analysis and Applications, vol 267, no 2, pp 444–453, 2002 10 W Takahashi, ... 2004 J Li, J K Kim, and N J Huang, “Iteration scheme for a pair of simultaneously asymptotically quasinonexpansive type mappings in Banach spaces,” Taiwanese Journal of Mathematics, vol 10, no ... asymptotically quasi-nonexpansive mappings in Banach spaces,” Panamerican Mathematical Journal, vol 14, no 1, pp 45–54, 2004 J K Kim, K S Kim, and Y M Nam, “Convergence and stability of iterative...
- 10
- 236
- 0
Báo cáo hóa học: "Research Article Generalized Mann Iterations for Approximating Fixed Points of a Family of Hemicontractions" potx
Ngày tải lên :
22/06/2014, 11:20
... Banach spaces,” Journal of Mathematical Analysis and Applications, vol 67, no 2, pp 274–276, 1979 10 W Takahashi, Nonlinear Functional Analysis Fixed Point Theory and Its Applications, Yokohama Publishers, ... theorems for strict pseudo-contractions in Hilbert spaces,” Journal of Mathematical Analysis and Applications, vol 329, no 1, pp 336–346, 2007 M O Osilike and S C Aniagbosor, “Weak and strong ... and centers in uniformly convex spaces,” Journal of Mathematical Analysis and Applications, vol 121, no 1, pp 10–21, 1987 S Reich, “Weak convergence theorems for nonexpansive mappings in Banach...
- 9
- 240
- 0
Báo cáo hóa học: " Research Article Iteration Scheme with Perturbed Mapping for Common Fixed Points of a Finite Family of Nonexpansive Mappings" doc
Ngày tải lên :
22/06/2014, 19:20
... steepest-descent methods with variable parameters for variational inequalities,” to appear in Journal of Optimization Theory and Applications [9] L C Ceng, P Cubiotti, and J.-C Yao, “Approximation of common ... Let H be a real Hilbert space and let F : H → H be a mapping such that for some constants k,η > 0, F is k-Lipschitzain vcommentand η-strongly monotone Let {Ti }N be N nonexpansive self-mappings ... families of nonexpansive mappings,” to appear in Taiwanese Journal of Mathematics [10] L C Ceng, P Cubiotti, and J.-C Yao, “Strong convergence theorems for finitely many nonexpansive mappings and...
- 10
- 195
- 0
Báo cáo hóa học: "A FIXED POINT THEOREM FOR A CLASS OF DIFFERENTIABLE STABLE OPERATORS IN BANACH SPACES" potx
Ngày tải lên :
22/06/2014, 22:20
... [5] V Azhmyakov, Stable Operators in Analysis and Optimization, Peter Lang, Berlin, 2005 [6] C Baiocchi and A Capelo, Variational and Quasivariational Inequalities Applications to Free Boundary ... [26] W Takahashi, Nonlinear Functional Analysis, Yokohama, Yokohama, 2000 [27] E H Zarantonello, Solving functional equations by contractive averaging, Tech Rep 160, Mathematics Research Centre, ... equation As a corollary of the general solvability results, we obtain a fixed point theorem for a family of Fr´ chet differentiable expanding operators in real Banach spaces e Some examples of stable...
- 17
- 536
- 0
Báo cáo hóa học: " Research Article Iteration Scheme with Perturbed Mapping for Common Fixed Points of a Finite Family of Nonexpansive Mappings" docx
Ngày tải lên :
22/06/2014, 22:20
... North-Holland, Amsterdam, The Netherlands, 2001 [13] M O Osilike, S C Aniagbosor, and B G Akuchu, Fixed points of asymptotically demicontractive mappings in arbitrary Banach spaces,” Panamerican Mathematical ... Ishikawa iteration process,” Journal of Mathematical Analysis and Applications, vol 178, no 2, pp 301– 308, 1993 [11] D Kinderlehrer and G Stampacchia, An Introduction to Variational Inequalities and ... A general iterative method for nonexpansive mappings in Hilbert spaces,” Journal of Mathematical Analysis and Applications, vol 318, no 1, pp 43–52, 2006 [5] M Maiti and M K Ghosh, “Approximating...
- 8
- 204
- 0
Báo cáo hóa học: " Research Article Iteration Scheme with Perturbed Mapping for Common Fixed Points of a Finite Family of Nonexpansive Mappings" ppt
Ngày tải lên :
22/06/2014, 22:20
... steepest-descent methods with variable parameters for variational inequalities,” to appear in Journal of Optimization Theory and Applications [9] L C Ceng, P Cubiotti, and J.-C Yao, “Approximation of common ... Let H be a real Hilbert space and let F : H → H be a mapping such that for some constants k,η > 0, F is k-Lipschitzain vcommentand η-strongly monotone Let {Ti }N be N nonexpansive self-mappings ... families of nonexpansive mappings,” to appear in Taiwanese Journal of Mathematics [10] L C Ceng, P Cubiotti, and J.-C Yao, “Strong convergence theorems for finitely many nonexpansive mappings and...
- 10
- 248
- 0
Báo cáo hóa học: " A FIXED POINT THEOREM FOR ANALYTIC FUNCTIONS VALENTIN MATACHE" doc
Ngày tải lên :
23/06/2014, 00:20
... Operators and Classical Function Theory, Universitext: Tracts in Mathematics, Springer-Verlag, New York, 1993 Valentin Matache: Department of Mathematics, University of Nebraska, Omaha, NE 68182, USA ... = ϕ(z) − |z|2 (2.7) It is always true that Λ = and |Λ| > |µ|, as the reader can readily check We are now ready to state and prove the main result of this mathematical note Theorem 2.2 If there ... in Advanced Mathematics, CRC Press, Florida, 1995 J B Garnett, Bounded Analytic Functions, Pure and Applied Mathematics, vol 96, Academic Press, New York, 1981 J H Shapiro, Composition Operators...
- 5
- 260
- 0
Be a Leader for God’s SakeBe A Leader for God’s Sake docx
Ngày tải lên :
27/06/2014, 23:20
... servant Be a Leader for God’s Sake leadership I believe his metaphor also applies to agapao leadership A Jazz band is an expression of servant leadership The leader of a jazz band has the beautiful ... something that made sense for a leader I examined the usage of agape and agapao in the New Testament and while agape seemed to refer to God’s love for us or for Jesus’ love for the Father, agapao seemed ... paradox of an agapao form of leadership, compared to an economic form of leadership, is that while the agapao leader concentrates less on the organization and more on individuals the organization...
- 199
- 294
- 0
Báo cáo toán học: "A Fixed Point Theorem for Nonexpansive Mappings in Locally Convex Spaces" ppt
Ngày tải lên :
06/08/2014, 05:20
... Uniformly lipschitzian families of transformations in Banach spaces, Canad J Math 26 (1974) 1245–1256 W A Kirk, A fixed point theorem for mappings which not increase distances, Amer Math Monthly 72 ... for Nonexpansive Mappings in Locally Convex Spaces 151 Clearly F is a nonempty family, since C ∈ F By weakly compactnees of C and Zorn’s Lemma, F has a minimal element H Now we shall show that ... λ (2) and A Fixed Point Theorem for Nonexpansive Mappings in Locally Convex Spaces 153 (For details, see [5]) In the sequel all topological notions (boundedness, compactness, weak compactness,...
- 7
- 295
- 0
Báo cáo khoa học: "Density of CD4(+) and CD8(+) T lymphocytes in biopsy samples can be a predictor of pathological response to chemoradiotherapy (CRT) for rectal cancer" ppt
Ngày tải lên :
09/08/2014, 09:20
... Kitayama J, Yasuda K, Kawai K, Sunami E, Nagawa H: Circulating lymphocyte number has a positive association with tumor response in neoadjuvant chemoradiotherapy for advanced rectal cancer Radiat ... performed before and after CRT, the longitudinal dimension of the rectal tumor was measured on BE images before (A) and after (B) CRT, and the reduction rate was calculated as (A- B) /A Biopsy samples ... samples, and mean value was calculated in each case The longitudinal length of the rectal tumor was measured by barium enema study before and after CRT, and the ratio of tumor reduction was calculated...
- 6
- 371
- 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx
Ngày tải lên :
11/08/2014, 08:20
... Lipman et al., (1994), and were kindly provided by Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' ... chosen that span introns of CD4 and CD8 genes in order to avoid amplification of cellular DNA contaminating RNA preparations Products are generated from cDNA and deletional mutants are constructed ... chosen as this was the largest number still within the linear range of the PCR (data not shown) In each assay we performed at least six different reactions for each sample using increasing amounts...
- 4
- 319
- 0
Báo cáo y học: " Pruritus: a useful sign for predicting the haemodynamic changes that occur following administration of vancomycin" ppsx
Ngày tải lên :
12/08/2014, 18:21
... radial artery cannula and pulmonary artery catheter [Arrow AH 050050-H, 7.5 F; Arrow International, Inc., Reading, PA, USA] transcutaneous oxygen saturation probe), vancomycin (15 mg/kg) was administered ... was transient, disappearing 15 later The reduction in systemic vascular resistance was not accompanied by a significant decrease in systemic arterial pressure, and because heart rate was unchanged, ... coronary patients were adequately monitored and the anaesthetist was therefore in the optimal conditions to detect and treat any change in cardiorespiratory function at an early stage Our analysis...
- 6
- 260
- 0
Báo cáo khoa học: " Is bronchoalveolar lavage with quantitative cultures a useful tool for diagnosing ventilator-associated pneumonia" doc
Ngày tải lên :
13/08/2014, 03:20
... Critical Care Vol 11 No Fagon et al Table Outcomes and antibiotics in the Canadian Critical Care Trials Group study [1] Endotracheal aspiration (n = 374) Bronchoalveolar lavage (n = 365) ... rate of targeted therapy was only 74.2% in the BAL arm, underlining the fact that, in many patients managed using this diagnostic technique, early deescalation was not performed although clearly ... Inappropriate use of antibiotics and the risk for delayed admission and masked diagnosis of infectious diseases: a lesson from Taiwan Arch Intern Med 2001, 161:2366-2370 Canadian Critical Care...
- 3
- 213
- 0