ban hành chiếu lập học b miễn lao dịch cho tất cả nông dân c cấm giết trâu bò d ban hành chiếu khuyến nông
Báo cáo y học: "Identification of an effective siRNA target site and functional regulatory elements, within the hepatitis B virus posttranscriptional regulatory element" ppt
Ngày tải lên :
12/08/2014, 01:21
... 5′-gatccagctcatcggaactgacaattcaagagattgtcagttccgatgagctttttttggaaa-3′; 5AtPRE1317 5′agcttttccaaaaaaagctcatcggaactgacaatctcttgaattgtcagttccgatgagctg-3′; PRE 1329 5′-gatccgctgacaattctgtcgtcctttcaagagaaggacgacagaattgtcagttttttggaaa-3′; ... and (iii) HBV PRE 1485-1584 (forward: HBV PRE_1485F 5′-tctagagctagctcgtccccttctccgtct-3′, reverse: HBV PRE_1584R 5′gccgg cctcgaggtgcacacggaccggcagat-3′) The Amplification was performed from a clone ... were created by annealing synthetic oligonucleotides: (i) forward: HBVSL_alpha oligoF 5′-ctag cgttttgctcgcagccggtctggggcaaagcc-3′, reverse: HBVSL_alpha oligoR 5′-tcgaggctttgccccagaccggctgcgagcaaaacg-3′;...
- 10
- 372
- 0
Báo cáo khoa học: Semi-nested PCR analysis of unknown tags on serial analysis of gene expression potx
Ngày tải lên :
07/03/2014, 04:20
... sequence No 11 matched multiclusters The rest of the sequences did not match any clusters Tag sequence UniGene ID Abundance A B C D E 10 ACTTACCTGC GCGTGCCTGC GCCCCTGCGC GTGACCACGG GTGGCACACG AACGAGGAAT ... Yes Blast results Consistency Consistency Consistency Inconsistency Consistency AK027322 Unmatched Unmatched Unmatched Unmatched Unmatched NR_003286 Mismatch Unmatched Unmatched –a BC010864 BC021246 ... whole cDNAs and the TSAT-PCR technique (A) In this process, double-stranded cDNAs synthesized by modified lock-docking oligo(dT) and 5¢-cap oligonucleotides were used for PCR During the PCR process,...
- 7
- 529
- 0
Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf
Ngày tải lên :
18/06/2014, 18:20
... GAPDH TBP HMBS B2 M 18sRNA PP1A TBP B2 M 18sRNA GAPDH BACT EEFIG B2 M* PPIA EEF1G SDHA TBP BACT 18sRNA EEF1G B2 M BACT SDHA HMBS PGK1 18sRNA GAPDH TBP B2 M BACT HMBS PGK1 18sRNA PP1A* PGK1* GAPDH* ... prepared the HIV infected MDDC extracts, and prepared the manuscript with CB SW carried out the QPCR experiments and conducted data analysis with the help of SM AC provided intellectual input, and ... available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral...
- 5
- 481
- 0
Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot
Ngày tải lên :
20/06/2014, 01:20
... GAPDH TBP HMBS B2 M 18sRNA PP1A TBP B2 M 18sRNA GAPDH BACT EEFIG B2 M* PPIA EEF1G SDHA TBP BACT 18sRNA EEF1G B2 M BACT SDHA HMBS PGK1 18sRNA GAPDH TBP B2 M BACT HMBS PGK1 18sRNA PP1A* PGK1* GAPDH* ... prepared the HIV infected MDDC extracts, and prepared the manuscript with CB SW carried out the QPCR experiments and conducted data analysis with the help of SM AC provided intellectual input, and ... available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright BioMedcentral...
- 5
- 574
- 0
Báo cáo y học: " Molecular analysis of HBV genotypes and subgenotypes in the Central-East region of Tunisia" potx
Ngày tải lên :
12/08/2014, 02:20
... Inactive carrier D D D D1 Inactive carrier D D D D1 Inactive carrier Inactive carrier D D D D D D D1 D1 Chronic hepatitis D D D D1 Chronic hepatitis D D D D1 Chronic hepatitis D D D D1 Chronic ... hepatitis D D D D7 23 Chronic hepatitis D D D D7 24 Cirrhosis D D D D7 25 Cirrhosis B D D D1 26 Cirrhosis B D D D1 27 Chronic hepatitis B D D D7 28 29 cirrhosis cirrhosis B B D D D D D7 D7 30 cirrhosis ... hepatitis D D D D1 10 Chronic hepatitis D D D D1 11 Chronic hepatitis D D D D1 12 13 Chronic hepatitis Chronic hepatitis D D D D D D D1 D1 14 Chronic hepatitis D D D D1 15 Chronic hepatitis D D D D1...
- 6
- 412
- 0
Tài liệu PCR-RFLP ANALYSIS OF BETA-LACTOGLOBULIN GENE IN MURRAH BUFFALOES pdf
Ngày tải lên :
18/02/2014, 02:20
... centrifuge tube and centrifuged at 4000 rpm for 10 and plasma was discarded leaving RBCs and WBCs Two to three volumes of ice cold RBC lysis buffer (0.17M NH4Cl) was added and kept on ice for complete ... lysis of RBCs The leucocytes were spun down at 4000 rpm for 15 and the supernatant containing lysed RBCs was discarded If unlysed RBCs were present, RBC lysis buffer was added and the procedure was ... – GTCCTTGTGCTGGACACCGACTACA-3’ Primer II: 5’ – CAGGACACCGGCTCCTGGTATATGA-3’ Reactions were carried out in 100ml volume The reaction conditions and reagent concentrations were:100pmole of each...
- 4
- 568
- 0
Báo cáo khoa học: Modified PCR methods for 3¢ end amplification from serial analysis of gene expression (SAGE) tags doc
Ngày tải lên :
07/03/2014, 00:20
... G or C Linker A: 5¢-TTTGGATTTGCTGGTGCAGTACAACTAGGCTTAATAGGGACATG-3¢ and 5¢-pTCCCT ATTAA GCCTAGTTGTACTGCACCAGCAAATCC-amino modified C7 -3¢ Linker B: 5¢-TTTCTGCTCGAATTCAAGCTTCTAACGATGTACGGGGACATG-3¢ ... and sequencing After visualizing speci c PCR product on an agarose gel, excise and purify individual bands Sequencing of purified PCR product can be performed by the standard dideoxynucleotide ... 5¢-AAGCAGTGGTATCAACGCAGAGTACGCGGG-3¢ PLF: 5¢-AAGCAGTGGTATCAACGCAGAGT-3¢ PLR: 5¢-CCAGACACTATGCTCATACGACG-3¢ Tag-speci c primer: 5¢-GGATCCCATGXXXXXXXXXX-3¢, where GGATCC is the BamHI site, and CATG(X)10...
- 12
- 544
- 0
Báo cáo khoa học: "Analysis of Salmonella enterica serotype Enteritidis isolated from human and chickens by repetitive sequence-PCR fingerprinting, antibiotic resistance and plasmid profiles" ppsx
Ngày tải lên :
07/08/2014, 18:21
... ;nillicipma :MA ;nillicinep :EP* S 7P nekcihC ET ,TS ,EP 01CS 3P nekcihC 90CS 3P nekcihC 80CS 8P nekcihC 70CS 5P nekcihC 60CS 6P nekcihC MA ,ET ,TS ,EP 50CS 1P nekcihC 40CS 1P nekcihC 30CS 1P nekcihC ... ksid elgnis dezidradnats a yb gnitset ytilibitpecsus citoibitnA CJ sirrehS ,MW ybriK ,WA reuaB secnerefeR noitcefni siditiretnE S fo ecruos eht ecart ot srekram lacigoloimedipe sa desu eb ylbaborp ... taht tcaf eht gniredisnoc ,sgge dna taem nekcihc sa hcus ,stcudorp nekcihc detanimatnoc eht morf detanigiro saw enolc eht taht detseggus eb thgim ti ,oslA enolc siditiretnE S cificeps yllacihpargoeg...
- 5
- 211
- 0
Báo cáo y học: " Quantitative biomarker analysis of synovial gene expression by real-time PCR" potx
Ngày tải lên :
09/08/2014, 01:23
... vertical axis shows the C( t) where the PCR product could be detected When the efficiency of the Q-PCR reaction using pure plasmid DNA (IL-6) or PBMC cDNA was compared, no significant difference ... single-stranded cDNA or a mRNA–cDNA hybrid with a target-specific secondary structure These differences cause the amplification efficiencies of the standard and the target to diverge during the first critical ... prepared and divided into five aliquots for further processing Each aliquot was individually assayed by Q-PCR using the standard curve method The CEs were determined based on the PBMC reference standard...
- 9
- 557
- 0
Báo cáo y học: "Analysis of bacterial DNA in synovial tissue of Tunisian patients with reactive and undifferentiated arthritis by broad-range PCR, cloning and sequencing" pps
Ngày tải lên :
09/08/2014, 10:23
... and revised the manuscript HF, MY, SB, NB and SS made pathological diagnosis, conducted sampling procedures, and performed clinical and rheumatological data analyses AZ, CB and EC conducted assessment ... Caulobacter leidyia, Curvibacter gracilis and Rhodococcus fasciens in control group samples We detected in ST samples some bacterial DNA sequences not previously characterized by rDNA sequencing ... Chlamydia trachomatis serology and DNA extraction BJ and JS participated in the design and coordination of the study, and drafted the manuscript AH and AS analyzed microbiological and sequencing...
- 14
- 500
- 0
báo cáo khoa học: " Isolation, identification and expression analysis of salt-induced genes in Suaeda maritima, a natural halophyte, using PCR-based suppression subtractive hybridization" doc
Ngày tải lên :
12/08/2014, 03:20
... DnaJ-For5'GGAATACAGGAGGGG GA CAT, Rev5'CCTTTTGGGAGAACCAAACA; BADH-For5' TGGAAAATTGCTCCAGCTCT, Rev5'CTGGACCTAATCCC GTCAAA; Actin-For5'AAACCACAAGCCCCTAAACC, Rev5 'TTGCATCACTCAGCACCTTC The PCR reaction conditions ... Rev5'AAGCCCGAAAACTCCAC TCT; Cat-For5'GAGTGGTTGATGCCCTGTCT, Rev5' TCTCATCTCGATCCCCAAAG; PEAMT-For5'TTGCCCTTGAG CGTTCTATT, Rev5'TACCTCCTGGCTTCAACCAT; P5 CSFor5'GATGTTTTTGCTGCCATTGA, Rev5' GC TAATC CC AACCTCAGCAC; DnaJ-For5'GGAATACAGGAGGGG ... that encoding CCL (CCR-like, cold circadian rhythm-RNA binding like) protein and carbonic anhydrase (CA) CCL gene encodes highly unstable mRNA, the stability being regulated by circadian clock [103]...
- 25
- 292
- 0
Báo cáo y học: " Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" pot
Ngày tải lên :
12/08/2014, 04:20
... 5’-GATAGTCCAGAAGAACCAACAAGAAG-3’, 0.4 μM molecular beacon 5’-CG CGCGATGAGGCATAGCAGCAGGATGAAGAACG CGCG-3’ labelled with FAM and Dabcyl at the 5’ and 3’ ends, respectively, Taq DNA polymerase, dNTP ... space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit ... Blood donor Blood donor 10 12 13 + + + + Blood donor 11 14 + + Blood donor 12 15 - - Blood donor 13 16 + - Blood donor 14 17 + + 13.5 Blood donor 15 18 + + 27.5 - + - Blood donor 16 19 - - - - + Blood...
- 6
- 536
- 1
Báo cáo y học: "Analysis of XMRV integration sites from human prostate cancer tissues suggests PCR contamination rather than genuine human infection" ppt
Ngày tải lên :
13/08/2014, 01:20
... GU816103 tgagccagatcatgcctctgcactccagcctgggcaacagagcaagactc tgagccagatcatgcctctgcactccagcctgggcaacagagcaagactc ************************************************** EU981808 GU816103 catctcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa ... dominant factor in determining target site specificity, a Page of A) EU981808 GU816103 CTCCTCAGAGTGATTGACTACCCAGCTCGGGGGTCTTTCAaaagcacaca ATTGACTACCCAGCTCGGGGGTCTTTCAaaagcacaca ************************************** ... catctcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa catctcaaaaaaaaaaaaaaaaaaaaaaaaaa -******************************** B) EU981810 EU981678 CTCCTCAGAGTGATTGACTACCCAGCTCGGGGGTCTTTCAatatgtttgg CTCCTCAGAGTAATTAACTACCCAGCTCGGGGGTCTTTCAatatgtttgg...
- 3
- 209
- 0
Báo cáo y học: "Base relative quantification framework and software for management and automated analysis of real-time quantitative PCR data" potx
Ngày tải lên :
14/08/2014, 17:22
... and mistakes can occur when preparing and performing qPCR reactions The erroneous data produced by these problems need to be detected and excluded from further data analysis to prevent obscuring ... calculated The effect of calibration with identical or independently prepared cDNA was studied similarly to the effect of the selection of IRCs The IRC stability measure was calculated as described ... expression In addition, any arbitrary cycle value can be chosen as the calibrator quantification cycle value The choice of calibrator sample or cycle value does not influence the relative quantification...
- 14
- 583
- 0
Static and Dynamic Analysis of Space frames
Ngày tải lên :
06/09/2012, 15:18
... according DIN Standard Code corrected External tendon calculation correction Principle tensile stress check according to DIN Standard added (Actions PrDinU and PrDinS added to Stage/Action modules) 3.44 ... Actions UltChk and UltRein modified Actions CracChk and RobuChk added to “Check actions” WindX option added to the AeroClass definition Load set group “Special” added for pier dimensioning Load set ... stresses calculation added (graphical presentation “Properties/CS” and stage action “PlShear”) New LoadSet DISCOR added (cable end displacement correction) Wind input modified (choice of integration...
- 19
- 633
- 0
Static and Dynamic Analysis of Spaceframes
Ngày tải lên :
06/09/2012, 15:55
... Guide Loading Case 16 CONSTRUCTION SCHEDULE Loads Lcase Stage Calculation Action Action Calculation Action Creep © TDV – Technische Datenverarbeitung Ges.m .b. H Define a new blank loading case ... Recalculate RM RM2000: Call for Fibre Stress calculation in the Construction Schedule Construction Schedule / Stage Calculation Action FibChk Results\PlSys Recalc © TDV – Technische Datenverarbeitung ... Check Calculation Procedure Guide 19 Fibre Stress Check Calculation GP2000: (Supposition: Bridge axis & girder cross section already defined) Cross-Section Select the Girder cross section and open...
- 34
- 1.1K
- 1
Static and Dynamic Analysis of Spaceframes
Ngày tải lên :
06/09/2012, 15:55
... Model Code 78 CS-CEB90.RMD CEB-FIP Model Code 90 CS-DI45.RMD DIN1045 Model Code CS-H54.RMD Hong Kong Model Code CS-HS54.RMD CS-HUNG.RMD Hungarian Code CS-NOR.RMD Norwegian Standard CS-OE47.RMD ... Structure and Functionality User Guide 1-2 CS-*.RMD Standard tables for Creep Variables definition: CS-AS96.RMD AASHTO Model Code 96 CS -B5 4.RMD CS-BS54.RMD BS5400 Model Code CS-CEB78.RMD CEB-FIP ... Database 1.2.1 Database principles – Objects and Attributes The RM2000 database is designed in accordance with the rules for an object oriented database Data consists of objects and attributes Objects...
- 484
- 1.2K
- 1
Báo cáo y học: "Medical resource utilization among patients with ventilator-associated pneumonia: pooled analysis of randomized studies of doripenem versus comparators"
Ngày tải lên :
25/10/2012, 10:02
... time above MIC in serum (fT>MIC) can be used as a surrogate for comparison This pharmacokinetic/pharmacodynamic index correlates with clinical efficacy and bactericidal activity and is used to determine ... analysis because they had valid ICU admittance dates but no valid ICU discharge dates and had hospital discharge dates (doripenem, 3; comparator, 6) Duration of hospitalization was defined as (discharge ... the individual studies Second, both study designs were open label, which may have affected medical resource utilization; however, bias should be minimal because the decision of whether to discharge...
- 10
- 557
- 1
Báo cáo y học: "Segment-orientated analysis of two-dimensional strain and strain rate as assessed by velocity vector imaging in patients with acute myocardial infarction"
Ngày tải lên :
25/10/2012, 11:15
... throughout the cardiac cycle The VVI algorithm includes speckle tracking, global motion coherence, and consistency of periodicity between cardiac cycles, which are described in detail in the producers ... mildly impaired after the AMI M-Mode and B- Mode transthoracic echocardiographic diameters and volumes are displayed in Table Table 2: Echocardiographic data set Ejection fraction, EF (%) IVSD (cm) ... LV ejection fraction (LV-EF) was calculated by the modified Simpson´s method LA and LV diameter were measured by M-Mode echocardiography High grade cardiac valvular disease was excluded by Color,...
- 8
- 683
- 0
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
Ngày tải lên :
26/10/2012, 09:57
... the Survey Demographics Demographics pertaining to age, gender, city of residence, annual income, and education were included Specifically, age, gender and city of residence defined the parameters ... schools/colleges: • Mr Marc Cianfrini (Vice Principal), Rick Hansen Secondary School, Mississauga, Canada • Ms Judi Powell (Guidance Counsellor), Rick Hansen Secondary School, Mississauga, Canada ... and Head of Department, Medicine, Mahatma Gandhi Mission’s http://www.medsci.org Int J Med Sci 2009, Medical College) • Dr Vallabh B Yadav (Professor and Head of Department, Community Medicine,...
- 12
- 757
- 0