backing up a database without affecting the normal sequence of backups

... gene was amplified by PCR using the BAC DNA as the template and oligos GGTCGACTTATATATTTATGAACACATTTA and CCCGGGATAACTTCGTATAATGTATGCTATACGAACGGTATCCTGAAATGGGGTCACCACACT The second primer contains ... and GGTCGACAGCTCACCAGGCCTCCCTGTCCCT Again, this fragment was cloned into pUC 19 and sequenced Lastly, the CAT ORF was released and purified away from the pB9 CAT recombinant plasmid [17] by a ... and sequenced A second fragment of 650 bp encompassing the UTR of αlac exon IV alongside 350 bp of the flanking region was amplified by PCR, using the BAC DNA as template and the primers CCTGCAGTCTTTGCTGCTTCTGTCCTCTTTC...

Ngày tải lên: 14/08/2014, 13:22

... (vi) Analyse the impact of managerial factors of the The thesis focuses on investigating factors affecting the Vietnamese companies on the capital structure; (vii) Propose the capital structure of ... determinants of the capital components rather than a market based value Besides, there company’s capital structure Factors relating to the asymmetric could be other factors that affect the capital ... Pushing ahead financial liberalization - Continue to liberalize the operation of financial institutions on financial market transparency of the companies’ corporate governance and financial information...

Ngày tải lên: 28/11/2014, 18:36

... this activity to a wider range of books which are still of importance to researchers and professionals, either for the source material they contain, or as landmarks in the history of their academic ... shewn that 12 of the crew have already attained to more than double that age, and unless some extraordinary fatality should befall them, it is certain that any Insurance Company which accepted the ... champions of the Oar My statistics are I believe calculated to dispel all such gloomy forebodings, and to show that the hardy disciples of the Isis and the Cam may fairly dispute the palm of health and...

Ngày tải lên: 14/02/2014, 21:20

... and the ability to link these data to higher-education databases makes it easier to gather this data today To further leverage these advances, a mechanism needs to be established that can gather ... the United States and Canada supported by the Carnegie Foundation for the Advancement of Teaching, the authors of Educating Lawyers: Preparation for the Profession of Law (Sullivan et al 2007) recommend ... taught and often are not an active part of faculty professional development plans (Lueddeke 2008; Diamond and Adam 2004) At a time when the costs of a university education are soaring and state...

Ngày tải lên: 18/02/2014, 01:20

... on the molecular mass value of HAD was measured; instead of an adduct increase, or no change, the value had unexpectedly decreased from 22 417.0 Da to 22 413.2 Da, a loss of Da MS ⁄ MS of these ... component gave a molecular mass of 16 309.7 Da, but this matched none of the DNA-predicted proteins MS ⁄ MS of these ions gave the C-terminal sequence of Fig These and all other peaks of that spectrum ... fragment peaks The ‘) 20 ’ after the molecular mass value signifies that the main component ion of the most abundant isotopic peak contains 20 13C atoms and has this mass value of identification that is...

Ngày tải lên: 18/02/2014, 16:20

... oscillations The main result of such an analysis is that oscillations arise if the parameter k3 is the largest and the parameters k6 and k7 are the smallest in the system Oscillations in this system can ... constructed of an even number of negative paths and any number of positive paths Our approach has the advantage that it considers positive and negative interactions in a unified manner The implication of ... state, oscillations can be obtained Analysis of negative and positive subgraphs and comparison of their values gives rise to the estimation of the kinetic parameters that enable such oscillations...

Ngày tải lên: 19/02/2014, 16:20

... that the skill-base approach is particularly useful in the case of the University of Massachusetts at Boston (UMB), since 89% of undergraduates and 82% of graduates remain in Massachusetts after ... hire an additional employee Suppose further that there are only two applicants for the position: one is a graduate of a local university and the other is a lifetime resident of another state According ... SKILL-BASE APPROACH Bluestone and others who have employed the skill-base approach begin their argument with the observation that a large percentage of a university's graduates remain in that state after...

Ngày tải lên: 20/02/2014, 19:20

... sulfate solution The amount of synthetized ATP was evaluated by adding 10–25 nM standard ATP ATP synthesis induced by acid-base transitions Acid-base driven ATP synthesis was carried out similarly ... varied between and lM The ATP concentration was evaluated by adding 100–200 nM standard ATP in each cuvette The basic solution was thermostated so that the ATP synthesis reaction took place at ... 3B is an enlarged view of Fig 3A showing only the rates obtained in the absence of a Du In this case, the impairment of the ATP synthesis rates in the mutant was higher than twofold, especially...

Ngày tải lên: 21/02/2014, 03:20

... showing the financial position of the organisation on the last day of the financial year The auditor will include a statement saying that the accounts have been drawn up in accordance with certain ... /21.67       total amount due Fundamentals of NGO Management Sick Annual Taken Annual leave days remaining 47 Fundamentals of NGO Management Annex 20: Honoraria agreement Name of organisation: An honorarium ... countries there are strict legal guidelines stating who can act as an auditor, often linked to the size of the organisation As well as auditing the annual accounts, the auditor is usually available...

Ngày tải lên: 06/03/2014, 21:20

... see the areas where research and analysis were mostly needed Gradually, the supply of analytical papers created a demand As a result, in terms of the scope of work completed, by the end of the ... a unique advantage of operating in Russia that was truly a “laboratory of a transitional economy.” Western researchers had no easy access to such a laboratory Therefore, HSE’s specialists dealing ... US$50, and the monthly salary of a professor at the major universities was US$100–120 This salary was much lower than a starting salary for many university graduates As a result, practically every...

Ngày tải lên: 08/03/2014, 06:20

... mutations for the Gly)10 residue into pC4Meth94PhoE, the EcoRI/BamHI fragment of the plasmid was replaced by PCR fragments created using the PhoE forward primer (5¢-GCCGGAATTCTAATATGAAAAAGAGCACTCT GGC-3¢) ... or Leu) at position )10 results in extension of the a- helical core region as indicated The leader peptidase cleavage site is depicted with an arrow analysis of signal sequences revealed the common ... domain and the C-terminal C domain The a- helix in the H domain is predicted to extend up to the Gly at position )10 in the signal sequence Introduction of an a- helix-stabilizing residue (Ala,...

Ngày tải lên: 08/03/2014, 09:20

Ngày tải lên: 12/03/2014, 00:21

... the venue A copy should be passed to the venue manager by the event manager Venue Choice (and audio visual) Suitability of the venue can mean more than just its layout and facilities Other facilities ... conferences and seminars, where there is a specific need to gather many delegates and speakers together in one place, there are significant opportunities available for ensuring that environmental impacts ... possible without laminating it [ ] Use easily transportable & reusable display materials [ ] Seek naturally lighted meeting & exhibition areas [ ] Format any handouts so as to minimise the amount of...

Ngày tải lên: 16/03/2014, 19:20

... specification of variables, and the automatic evaluation of formulas The proposed formula finder and trial translator systems are compatible; the former enables the semiautomatic derivation of basic ... in the formula; the machine will use only those variables that are actually required A THE AUTOMATIC SPECIFICATION OF VARIABLES AND EVALUATION OF FORMULAS Variables in the determiner formula and ... with the others B A SAMPLE TRANSLATION ALGORITHM Most of the syntactic and semantic algorithms proposed in the literature of machine translation can be stated as basic algorithms or as chains of...

Ngày tải lên: 16/03/2014, 19:20

... Situation, Table A- 12 (march 2010) This rate is seasonally adjusted U.s Department of Labor, Bureau of Labor statistics, Historical Data, Table A- 12 21 U.s Department of Labor, Bureau of Labor ... Department of Labor, Bureau of Labor statistics, The Employment Situation, historical Database U.s Department of Labor, Bureau of Labor statistics, The Employment Situation, Table A- 4 (December 2009 and ... Historical Data, Table A- 15 (seasonally adjusted) The Bureau of Labor statistics began tracking this statistic in its current form in 1994 U.s Department of Labor, Bureau of Labor statistics, The...

Ngày tải lên: 17/03/2014, 08:20

... evidence that the g ¼ 2.27 signal is not an artifact As regards the nature of the signal, the lack of a visible negative absorptionshaped peak at higher magnetic fields appears to be, at first glance, ... peak as well as the broad g ¼ 2.27 feature disappeared, whereas the narrow signal became more prominent At 23 K, the g ¼ 1.98 signal was observed as an undisturbed resonance of a single paramagnetic ... K, the axial signal around 13 K While the P1+ signal appeared to be slightly power saturated already above 25 mW, the axial signal remained unsaturated even at 200 mW However, both signals behaved...

Ngày tải lên: 18/03/2014, 01:20

... Materials and methods All mathematical analysis and numerical tting were performed using the software package Mathematica 7.0 (Wolfram Research, Inc Champaign, IL, USA) The substrate in the calorimetric ... and off rate At a xed k2, a change in this ratio may be interpreted as a change in the afnity of the enzyme for the substrate Hence, we can assess relationships of this afnity parameter and the ... examples of how the analysis of the kinetic parameters may elucidate certain aspects of the activity of Cel 7A First, we consider changes in the ratio k1S0 k3 This reects the ratio of the on rate...

Ngày tải lên: 28/03/2014, 23:20

... Ecuador El Salvador Granada Guatemala Guyana Haití Honduras Jamaica México Nicaragua Panamá Paraguay Perú República Dominicana Saint Kitts y Nevis San Vicente y las Granadinas Santa Luc a Surinam ... PAÍSES INDUSTRIALIZADOS Alemania Andorra Australia Austria Bélgica Canadá Chipre Dinamarca Eslovaquia Eslovenia Espa a Estados Unidos Estonia Finlandia Francia Grecia Hungr a Irlanda Islandia ... Singapur Tailandia Timor–Leste Tonga Tuvalu Vanuatu Viet Nam AMÉRICA LATINA Y EL CARIBE Antigua y Barbuda Argentina Bahamas Barbados Belice Bolivia Brasil Chile Colombia Costa Rica Cuba Dominica...

Ngày tải lên: 28/03/2014, 23:20

... the same anneal The glass first relaxed into the supercooled liquid (relaxed) state and crystallized with further isothermal annealing The regions marked as A- D indicate: (A) the heating of the ... stable it is against the thermal treatments that may present in the practical applications The aim of this study in general was to investigate the solidification and crystallization behaviour of ... METU Prof Dr Amdulla O Mekhrabov Metallurgical and Materials Eng Dept., METU Prof Dr İshak Karakaya Metallurgical and Materials Eng Dept., METU Asst Prof.Dr Kâzım TUR Materials Eng Dept., Atılım...

Ngày tải lên: 29/03/2014, 11:20

... 5¢-GTGTAGCGCGCGTGCG GCCC-3¢ The forward and reverse primers, respectively, for CaS were 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and 5¢-CAGTCGGAGCTAGGAAGGAA-3¢ Isolation of plasma membrane, intact chloroplasts, ... GGCTTAAUATGGCTATGGCGGAAATGG CAACGA) and nt115 (reverse: GGTTTAAUTAAGGATC CTTAATTAAGCCTCAGCGGGTCGGAGCTAGGAAG GAACTT), where the underlined sequence was included for regeneration of a USER cloning cassette The PCR ... phosphothreonine-specific antibody revealed the absence of the 40 kDa CaS phosphorylation in the stn8 mutant (Fig 4A) Analysis of the same fractions with CaSspecific antibody revealed similar levels of CaS in all samples...

Ngày tải lên: 30/03/2014, 04:20