... [10] The longer primer for detection of the wt allele was 5’-TTC AAG CCC TGA TGA TAA GGT CTT TGG CAT TAG ATG CTG TTT TGT TTT-3.’ The shorter primer was 5’-CTT TTG GCA TTA GAT GCT GTT TTG TCC TG-3.’ ... exclude the possibility that the observed associations are due to apoE rather than PPARδ in our study Conflicts of interest The authors have declared that no conflict of interest exists References ... inversely related to BMI Thus potential associations of PPARδ with HDL-C levels could be masked by the profound effect of overweight on HDL-C in the patients with high BMI To establish whether differences...
Ngày tải lên: 31/10/2012, 17:03
... are the goods listed in the registration cited as a bar to the registration of the mark applicant seeks to register Nine such third-party registrations were included, but the Examining Attorney ... submitted no evidence in support of any of these contentions We agree with the Examining Attorney and applicant that the critical question in the case before us centers on the relationship between ... that the record in this appeal clearly establishes that the goods set forth in the application are related to Ser No 75/934,127 those identified in the cited registration in such a way that the...
Ngày tải lên: 20/12/2013, 23:15
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf
... detected by both antibodies close to the theoretical pI of about 8.0 No degradation products of the allergen could be detected by either antibody However, the expression supernatant containing rPhl ... antibody It was further tested whether the truncated IG12-binding forms still possessed proteolytic activity after affinity purification IG12 affinity purification of supernatant containing the truncated, ... deuterated water (D2O) was shown to reduce expansin activity [14] The stronger hydrogen bonds of deuterated water are known to inhibit the formation of the tetrahedral intermediate step and thus...
Ngày tải lên: 08/03/2014, 22:20
Analysis of the atmospheric distribution, sources, and sinks of oxygenated volatile organic chemicals based on measurements over the Pacific during TRACE-P pdf
... global source estimates of CH3COCH3 obtained in these two studies The Jacob et al [2002] study finds that a global CH3COCH3 source of 95 Tg yrÀ1 fits the observational data better than the 56 Tg ... investigate these with respect to CO As we shall see, there is evidence that the contribution of non-BB CO in these free tropospheric (FT) plumes was quite small We also note that most of the ... [Mauzerall et al., 1998] We note that in some of the aged plumes there was no measurable ozone enhancement This somewhat low ozone ERCO can be attributed to the fact that much of the reactive nitrogen...
Ngày tải lên: 14/03/2014, 20:20
Báo cáo toán học: "Positivity of the T-system cluster algebra" pot
... contact with representation theory, it is desirable to have the coefficient set be enumerated by the roots of the Lie algebra In this context, we need to set the values of the coefficients to the ... z2 (t) = , T1 ,t+ 1,1 T1 ,t, 1 T1 ,t+ 1,2 T2 ,t, 0 T1 ,t 1,1 T1 ,t+ 1,1 T2 ,t, 0 z4 (t) = , z5 (t) = T2 ,t 1,0 T2 ,t, 1 T1 ,t, 2 T2 ,t 1,1 z1 (t) = z3 (t) = T1 ,t+ 1,1 T2 ,t 2,1 T1 ,t, 2 T2 ,t 1,0 and Z6 is a long step ... an N × (N + k)-matrix Let |P b1 , ,bk | be the determinant of the matrix obtained by deleting the k columns b1 , , bk of P , times the signature of the permutation that reorders these column indices...
Ngày tải lên: 08/08/2014, 01:20
Báo cáo toán học: "Preliminary measurement and simulation of the spatial distribution of the Morphogenetically Active Radiation (MAR) within an isolated tree canopy" docx
... bottom to the top of the tree crown Like in the PAR domain, the variability of the transmittance was more marked at the top and the bottom than in middle part of the tree crown The difference between ... at the top and the bottom than in the middle part of the tree Both PAR transmittance and reflectance tended to show vertical variation with smaller values at the top of the crown Leaf reflectance ... ii) the simplistic treatment of scattering in the model; iii) the high sensitivity of input parameters such as the diffuse to incident radiation ratio; iv) the severity of the test, since the...
Ngày tải lên: 08/08/2014, 14:22
Báo cáo khoa học: "Assessment of the spatial distribution of light transmitted below young trees in an agroforestry system S Meloni" pptx
... simulate the fine spatial pattern, as probably most of the models in the literature, because of the stochastic nature of transmitted radiation This suggests that the temporal distribution of the transmitted ... the model are the mean transmitted radiation at the soil level, the transmitted radiation in each soil cell (thus, the spatial distribution of the transmitted radiation on the whole scene), the ... many others, have noted that the extinction coefficient used in the Beer-Lambert’s law is not very sensitive to the inclination distribution The sensivity test made with the Sinoquet and Bonhomme...
Ngày tải lên: 08/08/2014, 18:21
báo cáo khoa học: " Cardiac tamponade and paroxysmal third-degree atrioventricular block revealing a primary cardiac non-Hodgkin large B-cell lymphoma of the right ventricle: a case report" pptx
... Chemotherapy remains the preferred initial treatment It should be guided by the immunohistological characteristics of the lymphoma and its extension to other Page of organs At the end of the treatment, ... infiltration of the roof of the side wall of the right atrium by the tumor tissue [7] TTE visualizes the pericardial effusions easily It also allows an estimation of its tolerance and reveals the ... intra-right ventricle obstruction Surgical resection of the mass was difficult and incomplete The tumor had infiltrated his right atrium, the atrioventricular septum and the proximal side of the right...
Ngày tải lên: 10/08/2014, 23:20
Báo cáo y học: "Association of the T allele of an intronic single nucleotide polymorphism in the colony stimulating factor 1 receptor with Crohn''''s disease: a case-control study" ppt
... differentiation of intestinal epithelial cells as it does in macrophages The most intense cytoplasmic staining occurred in the terminal web of the epithelial cell and in the lateral junctions of the ... literature regarding the expression of the CSF1R protein in the intestine despite documentation of its presence in the epithelium of a variety of other tissues including breast, ovary, endometrium, ... Authors' contributions AZV performed the molecular genetic studies and assisted in the recruitment of patients, the data analysis and the drafting of the paper SSN performed the sequencing RB...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: "Clinical relevance of the severe abnormalities of the T cell compartment in septic shock patients" ppt
... blood lymphocytes multiplied by the total number of lymphocytes per microlitre measured by a Coulter® Next, we obtained the absolute number of CD4+ and CD8+ T lymphocytes by multiplying the total ... in the recirculation of T lymphocytes between patients who survive septic shock and those who not Taken together and analysing the phenotype of the circulating T cells according to the activation ... patients with septic shock show different patterns of circulating T cell subsets Counts and distributions of the main circulating T lymphocyte subsets were systematically examined in 52 patients...
Ngày tải lên: 13/08/2014, 15:21
Báo cáo sinh học: " Spectratyping analysis of the islet-reactive T cell repertoire in diabetic NOD Igμnull mice after polyclonal B cell reconstitution" potx
... pathogenicity Furthermore, BV8S1 and BV8S2 are absent in the cyclophosphamide treated group (a treatment known to destroy regulatory T cells), but present in 50% of the B cell-reconstituted animals BV8S1 ... presenting B cells (B: T ratio of 4) which could be promoting the effector T cell repertoires unbalancing the regulatory clonotypes The number of CD19+ B cells circulating in blood post-reconstitution ... particular, members of the BV16 to 20 TCR repertoire were present at later time points (Figures 3B and 3C) These results demonstrate that B cell reconstitution is required before a progressive T...
Ngày tải lên: 18/06/2014, 19:20
o cáo hóa học:" Spectratyping analysis of the islet-reactive T cell repertoire in diabetic NOD Igμnull mice after polyclonal B cell reconstitution" docx
... pathogenicity Furthermore, BV8S1 and BV8S2 are absent in the cyclophosphamide treated group (a treatment known to destroy regulatory T cells), but present in 50% of the B cell-reconstituted animals BV8S1 ... presenting B cells (B: T ratio of 4) which could be promoting the effector T cell repertoires unbalancing the regulatory clonotypes The number of CD19+ B cells circulating in blood post-reconstitution ... particular, members of the BV16 to 20 TCR repertoire were present at later time points (Figures 3B and 3C) These results demonstrate that B cell reconstitution is required before a progressive T...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo khoa học: " Modulatory effects of chitosan adipate on the T and B lymphocyte subsets in mice" pps
... tsehgih si sitirtemodne fo ksir eht taht dnuof yduts rettal sihT ]03[ rehtona stcidartnoc tub ]31[ yduts suoiverp a htiw tnemeerga ni si ,yduts tneserp eht ni dnuof ,ytirap gnicnavda dna sitirtemodne ... ot detaler eb ot demuserp si noitatcal ylrae gnirud ytirap desaercni dna erocs noitidnoc ydob neewteb noitalerroc esrevni ehT ]63,91[ srehto yb detroper neeb sah sa ,ytirap yb detavargga eb ot ... cihpargonosartlu htob yb IA retfa syad 07 ot 06 mutcer rep denimreted erew oitar IA ot noitpecnoc ehT elur m.p -.m.a eht ot gnidrocca demrofrep saw IA syad 05 saw yduts siht rof dehsilbatse )IA( noitanimesni...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo y học: "Analysis of the 5''''UTR of HCV genotype 3 grown in vitro in human B cells, T cells, and macrophages" potx
... are reporting the isolation and replication of HCV from patients infected by type strains of HCV These new isolates can be cultured in both B and T cells By contrast to type strains of HCV, sequence ... lower Pn than HCV-1 samples This limited analysis agrees with the Shannon entropy data in that the variability of the cultured HCV-3 is lower than HCV-1 Distribution of variant bases in isolated HCV ... 314 T1 and 314 T2 were the same, showing that consecutive transfers of HCV into the same cell type not affect the sequence The 314 T1 and T2 sequences were almost identical to genotype H77, therefore...
Ngày tải lên: 12/08/2014, 04:20
Lời bài hát Rhythm Of The Rain
... tiếng mưa rơi Nó b o t i kẻ khờ T i ước t nh để khóc vô vọng Và b lại nỗi cô đơn thêm lần Oh, listen to the falling rain Pitter pater, pitter pater Oh, oh, oh, listen to the falling rain Pitter ... t ng bi t đâm chồi nảy lộc Listen to the rhythm of the falling rain Telling me just what a fool I've been I wish that it would go and let me cry in vain And let me be alone again ... listen to the falling rain Pitter pater, pitter pater Ô, lắng nghe nhịp điệu tiếng mưa rơi T t ch, t t ch Ô, ô, ô, lắng nghe nhịp điệu tiếng mưa rơi T t ch, t t ch ...
Ngày tải lên: 03/12/2015, 13:07
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... tion between the genotype and the BMI among the Table Genotype distribution in NT subjects and EH patients Table The association between genotype and phenotype Table Plasma BNP levels for patients ... known to affect human plasma BNP levels Thus, it is possible that the plasma BNP level is not an accurate reflection of the function of the NPPB gene In the present study, the overall distribution ... found that there was no significant difference between the two groups In fact, there were not enough subjects to allow the association studies to be done by gender Given our results, these limitations...
Ngày tải lên: 26/10/2012, 10:04
Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"
... inhibited by recombinant HBs but not by the recombinant LHBs The binding of SHBs with human hepatocytes was further supported by the observation from Bruin et al [39] They have found that the particles ... in the nucleus after two days of the post inoculation, this is agreement with the observation from DHBV [69] The result from the kinetic study on the internalization and transportation of HBV by ... confirmed the role of LHBs in the HBV attachment [23] Recently, the attachment site of LHBs was functionally narrowed down to the amino acids 21–47 of preS1 by employing synthetic peptides The results...
Ngày tải lên: 03/11/2012, 10:09
Effect of urban emissions on the horizontal distribution of metal concentration in sediments in the vicinity of Asian large cities
... mountains were considered to contain 20 mgPb/kg and 110 mgZn/kg based on the uniform distribution of these metals in the sediments of the lake The higher concentration in the northwest part of the ... the sediment concentration in this study, suggesting that the untreated wastewater is one of the important factors contributing to the elevated zinc concentration in the sediments, though - 69 ... by untreated wastewater and urban storm water on the distribution of metals is discussed The obtained metal concentrations in the sediments in the Philippines were compared with those in other...
Ngày tải lên: 05/09/2013, 09:08
Tài liệu Organic matter distribution of the root zone in a constructed subsuface flow wetland pptx
... decline of the filter ability of the constructed wetland The objective of this study is to survey the vertical and horizontal distribution of the OM in sand bed of the experimental constructed subsurface ... OM trend lines in the sand bed Figure gives the distribution of OM in terms of interpolated contour graphics at three depths 20 cm, 50 cm and 80 cm The differences in distribution of OM contents ... direction, the average value of OM in each cross-section is highest at the depth 50 cm and lowest at the depth 80 cm This result is in line with the visual observation of the sand color and the...
Ngày tải lên: 24/01/2014, 00:20
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...
Ngày tải lên: 16/02/2014, 09:20