b cell expression of interferon a

... production of autoantibodies directed against nucleic acid-associated targets Materials and methods Mice and treatment BALB/cJ mice were purchased from The Jackson Laboratory (Bar Harbor, ME, USA) IFNAR2-/- ... USA) PJU was a member of the scientific advisory boards of Monogram Biosciences, Inc (South San Francisco, CA, USA) and XDx, Inc (Brisbane, CA, USA) and is a cofounder of and consultant to Bayhill ... CM, Broughton C, Tabor AS, Akira S, Flavell RA, Mamula MJ, Christensen SR, Shlomchik MJ, Viglianti GA, Rifkin IR, MarshakRothstein A: RNA-associated autoantigens activate B cells by combined B cell...

Ngày tải lên: 09/08/2014, 14:22

... 5-CTT-GAA-ATC-ATC-CCT-GCG-AGC, antisense 5-TAG-GAC-TAG-CCA-TCC-ACT-GGG, internal probes, 5-GGA-GAG-AAG-CCA-CGC-ACA-CAC; CXCR3 primers — sense 5-TTT-GAC-AGA-ACC-TTC-CTG-CCA-G, antisense 5-AAA-CCC-ACT-GGA-CAG-CAG-CAT-C, ... using a statistical software package (StatView, Abacus Concept, Inc, Berkeley, CA, USA) and expressed as mean ± SEM Data groups were compared by analysis of variance; parameters whose variances ... 18:217-242 Bonecchi R, Bianchi G, Bordignon PP, D’Ambrosio D, Lang R, Borsatti A, Sozzani S, Allavena P, Gray PA, Mantovani A, Sinigaglia F: Differential expression of chemokine receptors and chemotactic...

Ngày tải lên: 09/08/2014, 01:23

... Takahashi H, Sawai H, Matsuo Y, Funahashi H, Satoh M, Okada Y, Inagaki H, Takeyama H, Manabe T: Reactive lymphoid hyperplasia of the liver in a patient with colon cancer: report of two cases BMC ... 23:302-308 11 Nakayama S, Yokote T, Kobayashi K, Hirata Y, Akioka T, Miyoshi T, Oka S, Hiraoka N, Iwaki K, Takayama A, Fukui H, Tsuda Y, Takubo T, Tsuji M, Higuchi K, Hanafusa T: Primary hepatic MALT lymphoma ... Joko K: A case of MALT lymphoma of the liver treated by RFA and Rituximab Nippon Shokakibyo Gakkai Zasshi 2006, 103:655-660, [Article in Japanese] Ota H, Isoda N, Sunada F, Kita H, Higashisawa T,...

Ngày tải lên: 09/08/2014, 01:24

... Medical University, 3029 Sfax, Tunisia 2Cardiovascular Surgery, Habib Bourguiba Hospital, 3029 Sfax, Tunisia Authors’ contributions ZF, LA, DA, SM, and SK analyzed and interpreted the patient data ... this article as: Frikha et al.: Cardiac tamponade and paroxysmal third-degree atrioventricular block revealing a primary cardiac nonHodgkin large B- cell lymphoma of the right ventricle: a case ... accentuated an increase of a myocardial blush in favor of the highly vascular nature of the tumor (Figure 4) This examination was performed because the patient was more than 40 years old It was thought...

Ngày tải lên: 10/08/2014, 23:20

... patients Gene expression analysis of MxA, a well-characterized IFN type I gene, was also undertaken as a control The association between miRNA expression and alanine aminotransferase (ALT) status, ... 5’-CTCTGTTATTCTCTGGTGAGTCT CCTT-3’; probe, 5’CATCACACATATCTGTAAATCTC TGCCCCTGTTAGA-3’) Co-amplification of the betaglucuronidase gene (Assay-On-Demand, Hs99999908_mL, Applied Biosystems) was used ... showed that IFN alpha in-vitro treatment of PBMCs leads to a transcriptional induction of all miRNAs investigated as well as MxA-mRNA (Figure 1) In particular, of the miRNAs Scagnolari et al Virology...

Ngày tải lên: 12/08/2014, 02:20

... Memory B cells 60% BBcells cells B cells CD27 Expression CD27 Expression Plasmablasts Naïve Naïve B cells B cells Memory Memory B cells B cells CD27 Expression Schematic distribution of B cell subsets ... 73 Agematsu K, Nagumo H, Yang FC, Nakazawa T, Fukushima K, Ito S, Sugita K, Mori T, Kobata T, Morimoto C: B cell subpopulations separated by CD27 and crucial collaboration of CD27+ B cells and ... importance is the fact that enhanced levels of B lymphocyte stimulator (BLyS; also known as B cell activating factor belonging to the TNF family [BAFF] or transmembrane activator and CAML interactor...

Ngày tải lên: 09/08/2014, 01:21

... expressed as an increase in normalized values over that observed with untreated cells Amplification primers for the human genes were as follows: BAFF, 5'-TGAAACACCAACTATACAAAAAG-3' and 5'-TCAATTCATCCCCAAAGACAT3'; ... concomitantly activate B cells by the local secretion of BAFF BAFF overexpression might have a pathogenic role in lymphomas, because increased BAFF expression was observed in some lymphomas, and an increased ... Mukhopadhyay A, Ni J, Zhai Y, Yu GL, Aggarwal BB: Identification and characterization of a novel cytokine, THANK, a TNF homologue that activates apoptosis, nuclear factor- B, and c-Jun NH2-terminal...

Ngày tải lên: 09/08/2014, 07:20

... Baran-Marszak F, Boukhiar M, Harel S, Laguillier C, Roger C, Gressin R, Martin A, Fagard R, Varin-Blank N, Ajchenbaum-Cymbalista F, Ledoux D: Constitutive and B- cell receptor-induced activation of ... Gerald WL, Linkov I, Bromberg JF: Requirement of matrix metalloproteinase-9 for the transformation of human mammary epithelial cells by Stat3-C Proc Natl Acad Sci USA 2004, 101(29):10602-7 Baran-Marszak ... staining of P-STAT3, (C) weak nuclear staining of STAT3, (D) weak nuclear staining of P-STAT3, (E) strong nuclear staining of STAT3, (F) strong nuclear staining of P-STAT3 Table Relationship between...

Ngày tải lên: 10/08/2014, 21:23

... Western blot images was used as a measure of assayed protein level The band image was acquired using an Alpha Imager and analyzed by the AlphaEase™ Stand Alone Software In Vitro Cell Permeability Assay ... were separated on a 1.5% agarose gel and stained by Ethidium Bromide (0.5 μg/ml) The band image was acquired using an Alpha Imager and analyzed by the AlphaEase™ Stand Alone Software (Alpha Innotech ... California, USA) and mouse antihuman β-actin monoclonal antibody (Cat No A1 978) were obtained from Sigma-Aldrich (St Louis, MO, USA) Rabbit anti-human PBEF polyclonal antibody was from Bethyl Laboratories,...

Ngày tải lên: 11/08/2014, 08:22

... Yamaoka S, Inoue H, Sakurai M, Sugiyama T, Hazama M, Yamada T, Hatanaka M: Constitutive activation of NF-kappa B is essential for transformation of rat fibroblasts by the human T -cell leukemia ... NF-kappaB in apoptosis-resistant T -cell transfectants with Tax J Virol 1999, 73:7981-7987 Kawakami A, Nakashima T, Sakai H, Urayama S, Yamasaki S, Hida A, Tsuboi M, Nakamura H, Ida H, Migita K, ... Constitutive activation of NF-kappaB in primary adult T -cell leukemia cells Blood 1999, 93:2360-2368 Mori N, Yamada Y, Ikeda S, Yamasaki Y, Tsukasaki K, Tanaka Y, Tomonaga M, Yamamoto N, Fujii M: Bay 11-7082...

Ngày tải lên: 13/08/2014, 09:21

... hybridization with the probe specifying cIAP2, cIAP2 RNA appeared as a special band located in the place with the molecular weight around kilo-base pair (Kb) (Figure 1B) Because the cIAP2 and ... Suzuki Y, Nakabayashi Y, Takahashi R Ubiquitin-protein ligase activity of X-linked inhibitor of apoptosis protein promotes proteasomal degradation of caspase-3 and enhances its anti-apoptotic ... caught by RNA binding spin cup After washing, DNA was degraded by the digestion of DNase Finally RNA was released from cup and stored in –70° C for use Micro-array analysis For gene array analysis,...

Ngày tải lên: 02/11/2012, 11:17

... using diaminobenzidine (DAB) (Boster Biological Technology, Wuhan, Hubei, China) The following antibodies were used: rabbit SRBI polyclonal antibody (1 : 1000, Abcam, Cambridge, MA, USA); rabbit ... KLF4, 5¢-CAA GTC CCG CCG CTC CAT TAC CAA-3¢ (forward) and 5¢-CCA CAG CCG TCC CAG TCA CAG TGG-3¢ (reverse); SR-BI, 5¢-CCT TCA ATG ACA ACG ACA CCG-3¢ (forward) and 5¢-CCA TGC GAC TTG TCA GGC T-3¢ ... Yang et al plays an important role in the activation of endothelial cells and macrophages, as well as the differentiation and proliferation of VSMCs Overexpression of KLF4 induced expression of...

Ngày tải lên: 18/02/2014, 04:20

... 3¢-UAUCCUGAAGAACUU UCCGUUGUAAUU-5¢; scrambled HO-2 siRNA: sense, 5¢-UAUAAGAGUCAGUACACAUCAUGGAAG-3¢, antisense, 3¢-UAAUAUUCUCAGUCAUGUGUAGUACCU-5¢ Another HO-2-specific siRNA, HO-2 siRNA1 (target base ... siHO-2, was designed and synthesized by iGENE Therapeutics (Tsukubu, Japan), and scrambled HO-2 siRNA was used as a negative control: HO-2 siRNA: sense, 5¢-AGGACUUCUUGAAAGGCAA CAUUAAAG-3¢, antisense, ... pig alveolar macrophages Arch Biochem Biophys 197, 607–617 Okinaga S, Takahashi K, Takeda K, Yoshizawa M, Fujita H, Sasaki H & Shibahara S (1996) Regulation of human heme oxygenase-1 gene expression...

Ngày tải lên: 19/02/2014, 05:20

... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon- gamma and induced by hypoxia in human retinal ... Nakayama M, Takahashi K, Kitamuro T, Yasumoto K, Katayose D, Shirato K, Fujii-Kuriyama Y & Shibahara S (2000) Repression of heme oxygenase-1 by hypoxia in vascular endothelial cells Biochem Biophys ... oxygenase by hemin in cultured pig alveolar macrophages Arch Biochem Biophys 188, 243–250 43 Okinaga S, Takahashi K, Takeda K, Yoshizawa M, Fujita H, Sasaki H & Shibahara S (1996) Regulation of...

Ngày tải lên: 19/02/2014, 06:20

... Tsuchida, M., Wanatabe, T., Haga, M., Matsumoto, Y., Abo, T & Eguchi, S (1995) Long-term survival of cardiac allografts in rats treated before and after surgery with monoclonal antibody to CD2 Transplantation ... fulfilled: (a) the conformation of backbone had an interproton error of less ˚ than 0.2 A compared to upper and lower boundaries of distances from ROE/NOE data and (b) the conformation had / angles ... MEM -a Jurkat cells were labeled the same day as the adhesion assay by loading with lM fluorescent dye biscarboxyethyl-carboxyfluorescein (BCECF-AM) at 37 °C for h Peptide dissolved in MEM -a was added...

Ngày tải lên: 19/02/2014, 13:20

... immunoprecipitation and mRNA studies (A) Cytospins of HepG2 cells were incubated with Nor3.2 followed by rabbit anti-(mouse Igs) and the alkaline phosphatase-antialkaline phosphatase (APAAP) conjugate, as ... inner face of the plasma membrane and that is translocated into the outer face under certain cellular states Double-labeling with Annexin V and CD1d revealed that a large number of HepG2 cells ... staining, cells were first permeabilized with 0.2% saponin Labeled cells were acquired in a FACSCalibur and analyzed using the CELLQUEST software (A) Histograms show cell surface expression of the transferrin...

Ngày tải lên: 19/02/2014, 16:20

... small vessels (V) and sebaceous glands (SG) surrounded by collagen (C) fibers are evident (Bb) An area of granulation tissue showing macrophage-like (blue arrows) and fibroblast-like cells (black ... Anti-mS10 0A8 immunostaining of rat wound days after injury (Ca) Low-power view of an area of mature granulation tissue and scar formation rich in collagen fibers and fibroblasts stained with anti-mS10 0A8 ... Pi and bound antibody detected after 30-min incubation with biotinylated caprine anti-rabbit IgG (Dako) and streptavidin-peroxidase (Kirkegaard & Perry Laboratories, Inc Gaithersburg, MA, USA)...

Ngày tải lên: 19/02/2014, 18:20

... catalase and bovine intestine alkaline phosphatase), phenyl–agarose, lectin-free Sepharose 4B and agarosebound concanavalin A, LCA, RCA, DNase I, ethidium bromide and DNA size markers were all ... normal and malignant human breast cells based on MPSS and array expression data Breast Cancer Res 8, R56 doi: 10.1186/bcr1604 50 Kobayashi T, Kubota K, Sudo K, Mori M, Sano K, Yotsuyanagi H & Makuuchi ... acetylcholinesterase and hydrophilic butyrylcholinesterase in the S1 supernatant of kidney were separated by taking advantage of the capacity of phenyl– agarose to adsorb amphiphilic cholinesterases [37] In addition,...

Ngày tải lên: 06/03/2014, 22:21

... NeuAca2-6Galb1-4GlcNAc-R NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp ... Gala1-O-pNp GalNAca1-O-pNp GlcNAca1-O-pNp Galb1-4GlcNAcb-O-octyl Galb1-3GlcNAcb-O-octyl Galb1-3GalNAca1-O-bn Galb1-4GlcNAc Galb1-3GlcNAc LNnT: Galb1-4GlcNAcb1-3Galb1-4Glc LNT: Galb1-3GlcNAcb1-3Galb1-4Glc ... Sf9 cells hST6Gal II was shown to be able to transfer a sialic acid residue onto a terminal Gal residue of asialofetuin and asialo -a1 -acid glycoprotein As shown in Table 1, the best acceptor substrate...

Ngày tải lên: 08/03/2014, 08:20

... probably because, as with guinea-pig CBG [23], the N-terminus was blocked Human liver cbg-1 cDNA cloning and sequence analysis A human liver cDNA library was screened by a conventional approach ... speci®city (kcat/Km) of reCBG for 4NPglycosides was b- D-fucopyranoside > a- L-arabinopyranoside > b- D-glucopyranoside > b- D-galactopyranoside > b- D-xylopyranoside > b- L-arabinopyranoside These data are ... nucleic acid labelling and detection kit (Amersham Pharmacia Biotech) The library was plated out on 20 cm ´ 20 cm bioassay plate (Nalge Nunc International, Naperville, USA) for the primary hybridization...

Ngày tải lên: 08/03/2014, 16:20