b 2 model clauses for changes in terms § 707 5 a

Accounting for Changes in Social Support Among Married Older Adults: Insights From the MacArthur Studies of Successful Aging pptx

Accounting for Changes in Social Support Among Married Older Adults: Insights From the MacArthur Studies of Successful Aging pptx

... physical performance, based on separate tests of physical ability (timed measures of gait, balance, chair stands, foot taps, and manual ability), was used to assess physical functioning For example, ... beliefs (i.e., relating to perceived ability to perform activities like keeping healthy; making arrangements for finances, transportation, and housing; staying safe; and managing general productivity) ... Self-efficacy A nine-item scale developed and validated by Rodin and McAvay (19 92) and found to be of particular relevance to older adults was used to assess participants’ self-efficacy in nine life...

Ngày tải lên: 06/03/2014, 15:20

10 449 0
ACCOUNTING FOR CHANGES IN BIODIVERSITY AND ECOSYSTEM SERVICES FROM A BUSINESS PERSPECTIVE potx

ACCOUNTING FOR CHANGES IN BIODIVERSITY AND ECOSYSTEM SERVICES FROM A BUSINESS PERSPECTIVE potx

... costs, earnings and savings and (b) physical information on the use, flows and destinies of energy, water and materials (including waste) EMA may be particularly valuable for internal management initiatives ... ‘fair’ information about the actual economic performance of the company Therefore, financial accounting and reporting are being dealt with in national laws and international accounting standards” ... developing CSR standards fairly daunting (Bhimani and Soonawalla, 20 05) Financial reporting has traditionally been the domain of national standard setting agencies, with the International                                                             ...

Ngày tải lên: 15/03/2014, 22:20

63 418 0
buy-sell agreement handbook, plan ahead for changes in the ownership of your business 2nd (2003)

buy-sell agreement handbook, plan ahead for changes in the ownership of your business 2nd (2003)

... reroll our cameras and give Xavier and Yolanda another chance Cousins Xavier and Yolanda incorporate a small business, again with Xavier receiving 55 % and Yolanda 45% of the corporation’s shares Even ... can disrupt a company’s management EXAMPLE: Cousins Xavier and Yolanda incorporate a small business, with Xavier receiving 55 % of the corporation’s shares and Yolanda 45% Each cousin serves as ... may have a claim against Dakon, but with Dakon off climbing mountains in Chile, Jed is unlikely to collect anything Although it’s impossible to prevent a business associate from acting as badly...

Ngày tải lên: 18/04/2014, 14:03

254 542 0
Báo cáo y học: " Mathematical model of blunt injury to the vascular wall via formation of rouleaux and changes in local hemodynamic and rheological factors. Implications for the mechanism of traumatic myocardial infarction" pot

Báo cáo y học: " Mathematical model of blunt injury to the vascular wall via formation of rouleaux and changes in local hemodynamic and rheological factors. Implications for the mechanism of traumatic myocardial infarction" pot

... 19 82, 83(1): 122 -5 Watt AH, Stephens MR: Myocardial infarction after blunt chest trauma incurred during rugby football that later required cardiac transplantation Br Heart J 1986, 55 (4):408-10 ... that takes into account local rheological and hemodynamic factors could be applied to many internal injuries involving an elastic vessel wall and a blunt traumatic mechanism One example is traumatic ... Theoretical Biology and Medical Modelling 20 05, 2: 13 http://www.tbiomed.com/content /2/ 1/13 that an increase in shear stress destroys rouleaux that have a cohesive force lower than the breaking force A...

Ngày tải lên: 13/08/2014, 22:22

10 345 0
The UN Model Double Taxation Convention in the context of Financing for Sustainable Development

The UN Model Double Taxation Convention in the context of Financing for Sustainable Development

... countries in drafting and negotiating bilateral tax treaties, with a view to maintaining the desired balance What isobtaining more tax revenue from foreign investment and special about the UN Model Convention? ... 13, paragraph 5, to address possible abuses • Optional version of Article 25 , providing for mandatory binding arbitration • New version of Article 26 , confirming and clarifying the importance of ... exchange of information • New Article 27 on “Assistance in the Collection of Taxes” • All changes in the above Articles accompanied by corresponding changes in the relevant Commentaries Other Changes...

Ngày tải lên: 05/09/2013, 14:19

14 489 0
A study of idioms containing terms for plants in english and vietnamese

A study of idioms containing terms for plants in english and vietnamese

... particular as well as finding the translational 5 .2. 2 Implication for Teaching Idioms Containing TsFPs equivalents are not an easy task due to semantic opacity, loss of the The need for learning ... ENGLISH AND of an English and Vietnamese idiom containing TsFPs because its VIETNAMESE IDIOMS CONTAINING TsFPs meaning can be made by associating its individual words’ meaning 4.4.1 Similarities ... Vietnamese also owns some typical idioms containing TsFPs under In Vietnamese the form of noun phrases Normally, they have a parallel structure root and branch, salad days, b i b nương dâu, b a rau...

Ngày tải lên: 26/11/2013, 13:28

13 1K 3
Tài liệu Security Essentials Day 2 Threat and the Need for Defense in Depth docx

Tài liệu Security Essentials Day 2 Threat and the Need for Defense in Depth docx

... says that “vulnerabilities are the gateways by which threats are manifested” So, for a threat model to have any meaning at all, there has to be a threat Are there people with the capability and ... that the program was replicating and reinfecting machines at a much faster rate than he had anticipated -there was a bug Ultimately, many machines at locations around the country either crashed ... password, the attacker can execute an integrity attack when they gain entrance to the system And they can even use an availability attack as part of their overall effort to neutralize alarms and...

Ngày tải lên: 09/12/2013, 17:15

31 573 0
Tài liệu UPCOMING CHANGES IN CABLING STANDARDS (2) pptx

Tài liệu UPCOMING CHANGES IN CABLING STANDARDS (2) pptx

... specifications for that cable type given in ANSI/TIA/EIA -56 8 -B. 2 and ANSI/TIA/EIA -56 8 -B. 3 NOTE: – Hybrid cables and bundled cables are those cables that are assembled prior to installation, sometimes ... Four-pair 100 Ohm category 5e cable as specified in ANSI/TIA/EIA -56 8 -B. 2 Two-fiber multimode optical fiber cable, either 62. 5/ 1 25 µm or 50 / 1 25 µm as specified in ANSI/TIA/EIA -56 8 -B. 3 Horizontal cabling ... 4-pair 24 AWG UTP cable shall be 110 N ( 25 lbf) For multipair backbone cable, manufacturer’s pulling tension guidelines shall be followed Connecting hardware termination As with all cabling media,...

Ngày tải lên: 21/12/2013, 18:15

27 332 0
Tài liệu Reporting Corrections of Errors and Changes in Accounting Principles - Amending SFFAS No. 7, Accounting for Revenue and Other Financing Sources pdf

Tài liệu Reporting Corrections of Errors and Changes in Accounting Principles - Amending SFFAS No. 7, Accounting for Revenue and Other Financing Sources pdf

... Staff: Andrea Palmer Federal Accounting Standards Advisory Board 441 G Street NW Suite 6814 Mailstop 6K17V Washington, DC 20 54 8 Telephone (20 2) 5 12- 7 350 FAX (20 2) 5 12- 7366 FASAB FASAB Federal Accounting ... modification The Board publishes adopted standards in a Statement of Federal Financial Accounting Standards Additional background information is available from the FASAB: • “Memorandum of Understanding ... material errors Accounting Research Bulletin 43, Chapter 2A, paragraph 101 Federal Accounting Standards Advisory Board Reporting Corrections of Errors and Changes in Accounting Principle October...

Ngày tải lên: 17/02/2014, 10:20

14 520 0
Tài liệu Báo cáo khoa học: Changes in purine specificity in tandem GAF chimeras from cyanobacterial cyaB1 adenylate cyclase and rat phosphodiesterase 2 pptx

Tài liệu Báo cáo khoa học: Changes in purine specificity in tandem GAF chimeras from cyanobacterial cyaB1 adenylate cyclase and rat phosphodiesterase 2 pptx

... tandem GAF domain of the Anabaena AC cyaB2 is specific for cAMP [8,9] Both GAF A and B bind cAMP (Fig 1A ,B, D,E) Again, the b1 b3 region is the major interaction site for the adenine moiety In b1 , ... 20 07 FEBS 151 5 Cyclic nucleotide specificity in GAF domains A CyaB2-GAFB-cAMP C J U Linder et al B D rPDE 2A- GAF -B- cGMP E CyaB2-GAF -A- cAMP CyaB2-GAF -B- cAMP Fig Structural properties of the b1 b3 sheets ... critical Thus we reasoned that a switch from cAMP to cGMP binding in the Anabaena tandem GAF domains probably requires structural changes in the b1 b3 region Because in the tandem GAF domain of cyaB2...

Ngày tải lên: 19/02/2014, 02:20

10 468 0
CHANGES IN GERMANY’S BANK-BASED FINANCIAL SYSTEM: IMPLICATIONS FOR CORPORATE GOVERNANCE pot

CHANGES IN GERMANY’S BANK-BASED FINANCIAL SYSTEM: IMPLICATIONS FOR CORPORATE GOVERNANCE pot

... is that Germany's role in international finance was lagging far behind its importance in trade and industry In particular Frankfurt was seen as relatively weak as an international financial center ... competition among banks led to a narrowing of this interest rate spread The main alternative to interest-based income for banks is fee-based income, such as investment banking and asset management ... Germany's bank-based financial system is being transformed, and what implications these changes have for company finance and corporate governance This article describes these changes and argues that a...

Ngày tải lên: 06/03/2014, 10:20

18 529 1
TYPE 2 DIABETES - National clinical guideline for management in primary and secondary care (update) pdf

TYPE 2 DIABETES - National clinical guideline for management in primary and secondary care (update) pdf

... inhibitor ACR Albumin creatinine ratio ADA American Diabetes Association AER Albumin excretion rate – a measure of kidney damage due to diabetes (and other conditions) and a risk factor for arterial ... haemoglobin estimation (if abnormal haemoglobins) R21 46 When setting a target glycated haemoglobin HbA1c: q involve the person in decisions about their individual HbA1c target level, which may be above ... vegan diet Diet based on ADA guidelines Weight=NS HbA1c=NS * A kg decrease in weight at year was associated with a 0.4% decrease in HbA1c Observational studies In an observational study with years...

Ngày tải lên: 08/03/2014, 14:20

278 1.3K 0
Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx

Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx

... Manb1fi2Manb1fi2Manb1fi2Mana1 2 Manb1fi2Manb1fi2Manb1fi2Mana1 2 Manb1fi2Manb1fi2Mana1 2 Manb1fi2Manb1fi2Mana1fi3 Manb1fi2Manb1fi2Mana1 2( 3) Manb1fi2Mana1 2 Manb1fi2Mana1fi3 Mana1fi6 Manb1fi2Manb1fi2Mana1fiphosphate Manb1fi2Manb1fi2Mana1fiphosphate ... a1 fi6Mana1fi6Mana1fi6Mana1fi6 2 2 2 a1 fi2Mana1 Mana1 2 Mana1fi6 a1 fi6Mana1fi6 a1 fi3Mana1 2 Manb1fi2Mana1fi3 Manb1fi2Manb1fi2Mana1fi3 Manb1fi2Mana1 2 Manb1fi2Manb1fi2Mana1 2 Manb1fi2Manb1fi2Manb1fi2Mana1 2 Manb1fi2Manb1fi2Manb1fi2Mana1 2 ... LM5; j, LM6; s, Manb1fi2Mana1fi 2Mana1fi2Mana1fi2Man; d, Manb1fi2Manb1fi2Mana1fi2Man a1 fi2Mana1fi2Man; n, Manb1fi2Mana1fi3Mana1fi2Mana1fi 2Man; m, Manb1fi2Manb1fi2Mana1fi3Mana1fi2Mana1fi 2Man Because we could assign...

Ngày tải lên: 17/03/2014, 03:20

11 456 0
An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf

An application of GIS and Remote Sensing for Analysis of Agricultural Development-Induced Changes in Land Use: A case study in Lao PDR pdf

... northern Laos, Lat: 65 07'16" to 67 59 '13" Long: 22 2º79'96" to 22 5 56 '22 " 43 villages Study area 1 25 0msl 300msl • • Area 696 km2 • Watershed boundary area = 22 km2 • Elevation from 300 to 1 ,23 5 msl ... Mixed-deciduous forest 52 8 6 . 25 24 .10 28 27.38 12. 8 Dense forest 58 13.31 26 .50 41 12. 13 18.7 Shifting cultivation 6061.94 27 .64 11 657 .81 53 .1 21 9 35. 50 100.0 21 9 35. 5 100.0 Total areas 16 Zonation Ground information  ... Disturbed 353 53 2, 209 .56 22 .10 3.17 Bare land > Disturbed 389 75 2, 4 35. 94 24 .36 3 .50 Disturbed > Field crop 867 54 .19 0 .54 0.08 Wet paddy > Field crop 9 32 58 . 25 0 .58 0.08 Disturb > Wet paddy 55 04...

Ngày tải lên: 17/03/2014, 11:20

24 897 0
A Model Course for Public Health Education in Chiropractic Colleges: A Users Guide doc

A Model Course for Public Health Education in Chiropractic Colleges: A Users Guide doc

... need for chiropractic training in public health Dillard, in discussing the professions needs for integration into the mainstream of health care suggested that; “to maintain and increase a mainstream ... was 44% for medical only , 58 % for combined, physical exam was 46% for medical only, 55 % combined, and BP was 75% for medical only, 92% combined (30) Assessment and counseling for physical activity, ... Alternative Medicine Use in the US, 1990-1997 JAMA 1998 ;28 0: 156 9- 157 5 28 Astin J Why Patients Use Alternative Medicine JAMA 1998 ;27 9: 154 8- 153 3 29 Carey TS, Evans A Handler N et al Care seeking among...

Ngày tải lên: 22/03/2014, 15:20

76 376 0
Báo cáo " Balance of rice for the Mekong Delta - Viet Nam to 2050 in terms of industrialization and climate change '''' doc

Báo cáo " Balance of rice for the Mekong Delta - Viet Nam to 2050 in terms of industrialization and climate change '''' doc

... 153 8.6 20 40 (+,-) -6 65 OS S1 20 50 (+,-) OS S1 24 163. 023 076.1 -1086.9 26 956 . 52 5 364 .5 (+,-) - 15 92 14 12. 2 124 9.1 -163.1 120 4.0 947.4 - 25 6.6 993.9 6 32. 3 17 4 25 .3 20 356 .5 29 31 .2 13330 .51 46 92. 8 13 62. 3 ... S1 20 50 (+,-) OS S1 (+,-) 19414.6 19414.6 21 659 .22 1 659 .2 24163. 024 163.0 26 956 . 52 6 956 .5 1619.8 1684.8 65 14 12. 2 153 8 .2 126 120 4.0 1390.0 186 993.9 123 9.9 24 6 -Rice D-S -E 1000 tons 17 4 25 .3 21 53 3.1 ... people, in 20 30 is 21 .7 million and will be reaching 26 .9 million in 20 50 Research results also showed that agricultural labor and labor involved in the production of rice continue to increase in absolute...

Ngày tải lên: 24/03/2014, 01:21

7 528 2
Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt

Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt

... template for two successive point mutations C60F and C47 3A were introduced using primers P4 (5 -atgtagccattgtatttgaaaatgagcaact) and P5 (5 - agttgctcattttcaaatacaatggctacat), and P6 (5 - gaacagc ... using primers P8 (5 -ccctacggaaacaac gatcgctgcgactacatgggta) and P9 (5 -tacccatgtagtcgcagcgatcg ttgtttccgtaggg), and P10 (5 -tgaagctggtgaattatcgattggtggagaa ggg) and P11 (5 -cccttctccaccaatcgataattcaccagcttca), ... involve a productive domain–domain interaction between the A domain and the PCP domain To trap the holoenzyme in such a conformation, the natural substrates ATP and phenylalanine are not suitable because...

Ngày tải lên: 29/03/2014, 08:20

13 494 0
w