attention guided recognition based on what and where representations a behavioral model pages 663 670 ilya a rybak valentina i gusakova alexander v golovan pdf

Báo cáo khoa học: "Japanese Named Entity Recognition based on a Simple Rule Generator and Decision Tree Learning" pdf

Báo cáo khoa học: "Japanese Named Entity Recognition based on a Simple Rule Generator and Decision Tree Learning" pdf

Ngày tải lên : 08/03/2014, 05:20
... Masaki Murata, Hiromi Ozaku, Masao Utiyama, and Hitoshi Isahara 2000 Named entity extraction based on a maximum entropy model and transformation rules (in Japanese) Journal of Natural Language ... training data For instance, a morphological analyzer may divide a four-character expression OO-SAKA-SHI-NAI into two words OO-SAKA (= Osaka) and SHINAI (= in the city), but the training data ... Paliouras, Vangelis Karkaletsis, Georgios Petasis, and Constantine D Spyropoulos 2000 Learning decision trees for named-entity recognition and classification In ECAI Workshop on Machine Learning...
  • 8
  • 530
  • 0
Báo cáo hóa học: " Research Article Fusion of Appearance Image and Passive Stereo Depth Map for Face Recognition Based on the Bilateral 2DLDA" ppt

Báo cáo hóa học: " Research Article Fusion of Appearance Image and Passive Stereo Depth Map for Face Recognition Based on the Bilateral 2DLDA" ppt

Ngày tải lên : 22/06/2014, 19:20
... M Visani, C Garcia, and J.-M Jolion, “Two-dimensionaloriented linear discriminant analysis for face recognition, ” in Proceedings of the International Conference on Computer Vision and Graphics ... Clarkson, T Jebara, and A Pentland, “Multimodal person recognition using unconstrained audio and video,” in Proceedings of the 2nd International Conference on Audio- and Video -Based Person Authentication ... S Malassiotis, and M G Strintzis, “The HISCORE face recognition application: a ordable desktop face recognition based on a novel 3D camera,” in Proceedings of International Conference on Augmented,...
  • 11
  • 415
  • 0
kỹ thuật what and where and Where

kỹ thuật what and where and Where

Ngày tải lên : 26/06/2013, 01:25
... WHAT AND WHERE ONE TWO FOUR SIX SEVEN TEN WHAT AND WHERE ONE TWO FOUR SIX SEVEN TEN ...
  • 3
  • 441
  • 2
The Breast Cancer Epidemic: Modeling and Forecasts Based on Abortion and Other Risk Factors potx

The Breast Cancer Epidemic: Modeling and Forecasts Based on Abortion and Other Risk Factors potx

Ngày tải lên : 06/03/2014, 02:21
... 0.5 Level Sw eden 0.25 Level This model has desirable mathematical properties such as dimensional homogeneity, linearity, additivity, and parsimonious parameterization The model makes sense in terms ... Ireland as reported in English abortion statistics are used to derive abortion rates for Northern Ireland The trends in abortion and fertility in Northern Ireland are shown in Figures and Abortion ... resident in the Republic in English abortion statistics are used to derive Irish abortion rates The trends in abortion and fertility in the Republic of Ireland are shown in Figures and Abortion...
  • 7
  • 405
  • 0
Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx

Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx

Ngày tải lên : 07/03/2014, 11:20
... oligos, 5¢-tcgacttctagagctctggaggcttgctgaaggctgtatgc tagagacgtacagatgcgtctcacaggacacaaggcctgttactagcactcacatgg aacaaatggccg-3¢, and 5¢-aattcggccatttgttccatgtgagtgctagtaaca ggccttgtgtcctgtgagacgcatctgtacgtctctagcatacagccttcagcaagcct ... USA) Monoclonal anti- (a- tubulin) was from Sigma-Aldrich (St Louis, MO, USA) Goat antimouse and anti-rabbit IgG conjugated to Alexa 680 were from Invitrogen Goat anti-mouse and anti-human IgG conjugated ... attggtcttactgacatccactttgcctttctctccacaggtgtcg-3¢ and 5¢-gtac cgacacctgtggagagaaaggcaaagtggatgtcagtaagaccaataggtgcctat ctggtccacgcgtatgcgatatcagcagctagcgccg-3¢, and pEGFP-N1 cut by NdeI and Acc6 5I, to generate pEGFP-N1-Intron...
  • 7
  • 514
  • 0
photocatalytic nanocomposites based on tio2 and carbon nanotubes

photocatalytic nanocomposites based on tio2 and carbon nanotubes

Ngày tải lên : 20/03/2014, 13:06
... 3-21 Curve fitting (the first order of exponential decay) and extrapolation of spore inactivation data by anatase nanocoated carbon nanotubes and Degussa Aeroxide® P25 with UV -A irradiation ... mass production However, antibiotics are not effective against viruses and vaccines are not available for most severe viral diseases Among these are the viral hemorrhagic fevers (VHFs) that include ... and fibers based on TiO2 and multi-walled carbon nanotubes were developed for photocatalytic applications, such as purification of organic contaminants and disinfection of hazardous microorganisms...
  • 107
  • 555
  • 0
09 - personalized email prioritization based on content and social network analysis

09 - personalized email prioritization based on content and social network analysis

Ngày tải lên : 22/03/2014, 22:26
... classification to model user priorities among incoming email messages We treat the priority prediction task as a supervised classification problem and use standard support vector machines (SVMs) ... research centers on statistical learning methods for a range of problems, including large-scale text categorization, relevance- and novelty -based retrieval and adaptive filtering, personalization ... modeling, and simulation Moon has a PhD in computation, organization, and society from Carnegie Mellon University Contact him at icmoon@smslab.kaist.ac.kr in the range from 10 −3 to 103, and the values...
  • 7
  • 537
  • 0
Báo cáo khoa học: Structural requirements for Caenorhabditis elegans DcpS substrates based on fluorescence and HPLC enzyme kinetic studies pdf

Báo cáo khoa học: Structural requirements for Caenorhabditis elegans DcpS substrates based on fluorescence and HPLC enzyme kinetic studies pdf

Ngày tải lên : 29/03/2014, 09:20
... organisms Mutations of these crucial amino acids resulted in enzyme inactivation or a signicant decrease in activity [20] Two amino acids, Asp205 and Lys207, are involved in interactions with ... scavengers supports the functional signicance of this domain in decapping activity Substitution mutagenesis of the central histidine in human and nematode decapping scavengers inactivates their ... ARCA (anti-reverse cap analogs) which are commercially available and used as substrates for in vitro transcription reactions [27,28] Such analogs prevent their reverse incorporation into mRNAs,...
  • 11
  • 438
  • 0
Báo cáo khoa học: "The Corpora Management System Based on Java and Oracle Technologies" potx

Báo cáo khoa học: "The Corpora Management System Based on Java and Oracle Technologies" potx

Ngày tải lên : 31/03/2014, 20:20
... r#SEARCH_ID = SEAR C H_E) A Figure Fragment of UML notation of data model UML specification of business services uses standard UML notations of standard linguistic annotation and corpora manipulation ... support In order to use Oracle Text capabilities we add Russian Grammatical Dictionary (morphosyntactic dictionary) that consists of word paradigms with grammatical characteristics of all Corpora word ... Flexible Storage Location - documents can be stored and indexed in the database, in a location pointed to by a URL or in an external file • Corpora Graphical Display and Navigation System services...
  • 4
  • 346
  • 0
mechanical properties of polymers based on nanostructure and morphology, 2005, p.738

mechanical properties of polymers based on nanostructure and morphology, 2005, p.738

Ngày tải lên : 04/06/2014, 14:26
... Cheremisinoff and Paul N Cheremisinoff Diffusion in Polymers, edited by P Neogi Polymer Devolatilization, edited by Ramon J Albalak Anionic Polymerization: Principles and Practical Applications, ... Thermoforming: Principles and Applications, Second Edition, Revised and Expanded, John Florian Macromolecular Design of Polymeric Materials, edited by Koichi Hatada, Tatsuki Kitayama, and Otto Vogl Handbook ... electricity and magnetism at the University of Madrid He spent many years as a research associate and visiting professor in various international institutions, including the Fritz Haber Institute...
  • 738
  • 2.8K
  • 0
báo cáo hóa học: " Human-machine interfaces based on EMG and EEG applied to robotic systems" pot

báo cáo hóa học: " Human-machine interfaces based on EMG and EEG applied to robotic systems" pot

Ngày tải lên : 19/06/2014, 10:20
... partnership between Federal University of Espirito Santo, Vitoria, Brazil, and National University of San Juan, San Juan, Argentina, through the binational program CAPG-BA As part of this financial ... electrodes placed on standard fronto-centro-pariental positions, in a non-invasive way Spatial filtering, Welch periodogram algorithm and a statistical classifier were used to recognize mental tasks, ... conditioning it (by filtering and amplifying it) Following, the analog signal just acquired is converted to a digital one (A/ D converter), which is delivered to a PC The second part of the BCI...
  • 15
  • 379
  • 0
Báo cáo hóa học: " Research Article Design and Experimental Evaluation of a Vehicular Network Based on NEMO and MANET" pdf

Báo cáo hóa học: " Research Article Design and Experimental Evaluation of a Vehicular Network Based on NEMO and MANET" pdf

Ngày tải lên : 21/06/2014, 08:20
... related to VANET applications, as well as basic research at the physical link and network layers in vehicular communications, there is an important lack of real evaluation analysis Many VANET ... latency and bandwidth dynamically change according to available interfaces, mobility or obstacles Adaptive applications are thus desirable in these environments Second, traffic flows have to be allocated ... allocated to appropriate paths depending on the application demands and network performances Since real-time applications are sensitive to handovers, an intelligent path allocation is required Third,...
  • 18
  • 596
  • 0
Báo cáo sinh học: " Research Article Improved Adaptive LSB Steganography Based on Chaos and Genetic Algorithm" ppt

Báo cáo sinh học: " Research Article Improved Adaptive LSB Steganography Based on Chaos and Genetic Algorithm" ppt

Ngày tải lên : 21/06/2014, 16:20
... EURASIP Journal on Advances in Signal Processing Preliminary c0 2.1 Chaos and Its Application in Information Hiding The chaos phenomenon is a deterministic and analogously stochastic process appearing ... computer simulation in which a population of abstract representations of candidate solutions to an optimization problem evolves toward better solutions The evolution usually starts with some randomly ... appearing in a nonlinear dynamical system [8, 9] Because of its extreme sensitivity to initial conditions and the outspreading of orbits over the entire space, it has been used in information hiding...
  • 6
  • 343
  • 0
Báo cáo sinh học: " Research Article Robust Iris Verification Based on Local and Global Variations" pptx

Báo cáo sinh học: " Research Article Robust Iris Verification Based on Local and Global Variations" pptx

Ngày tải lên : 21/06/2014, 16:20
... 2007 11 [9] H Takano, H Kobayashi, and K Nakamura, “Rotation invariant iris recognition method adaptive to ambient lighting variation,” IEICE Transactions on Information and Systems, vol E90-D, no ... generalization capability Above all, an SVM classifier is insensitive to the relative numbers of training examples in positive and negative classes which plays a critical role in our classification ... recognize noisy and non-ideal iris images and leave rather ideal images to traditional iris recognition methods This will enhance acceptability of irisbased authentication systems through preventing...
  • 12
  • 359
  • 0
Báo cáo hóa học: "Research Article Stability and Convergence Results Based on Fixed Point Theory for a Generalized Viscosity Iterative Scheme" pot

Báo cáo hóa học: "Research Article Stability and Convergence Results Based on Fixed Point Theory for a Generalized Viscosity Iterative Scheme" pot

Ngày tải lên : 21/06/2014, 20:20
... each sample see Assumption Another generalization is the inclusion of a nonnegative term with generalized contractive mapping Q : W → W involving another iterative scheme evolving on another, and ... Functional Differential Equations, Dover Publications, Mineola, NY, USA, 2006 Fixed Point Theory and Applications 19 P N Dutta and B S Choudhury, A generalisation of contraction principle in metric ... fixed points of the positive iteration schemes 4.1 and 4.27 contain a common stable equilibrium point ∈ Rm which is a unique solution to the variational equations of Theorems 4.8 and 4.9; that is,...
  • 19
  • 350
  • 0
Báo cáo hóa học: "Research Article Mode Switching for the Multi-Antenna Broadcast Channel Based on Delay and Channel Quantization" pot

Báo cáo hóa học: "Research Article Mode Switching for the Multi-Antenna Broadcast Channel Based on Delay and Channel Quantization" pot

Ngày tải lên : 21/06/2014, 20:20
... approximation [40, 41], the quantization cell approximation is based on the ideal assumption that each quantization cell is a Voronoi region on a spherical cap with the surface area 2−B of the total ... communication—part I: channel inversion and regularization,” IEEE Transactions on Communications, vol 53, no 1, pp 195–202, 2005 [40] K K Mukkavilli, A Sabharwal, E Erkip, and B Aazhang, On beamforming ... quantization error, plus other CSIT imperfections such as estimation error and delay In addition, most of prior work focused on the achievable spatial multiplexing gain, mainly based on the analysis...
  • 15
  • 367
  • 0
báo cáo hóa học:" Research Article Data Fusion Boosted Face Recognition Based on Probability Distribution Functions in Different Colour Channels" ppt

báo cáo hóa học:" Research Article Data Fusion Boosted Face Recognition Based on Probability Distribution Functions in Different Colour Channels" ppt

Ngày tải lên : 21/06/2014, 20:20
... Demirel, G Anbarjafari, and M N S Jahromi, “Image equalization based on singular value decomposition,” in Proceedings of the 23rd International Symposium on Computer and Information Sciences (ISCIS ’08), ... properties are desired for the formation of the intensity image which is a product of reflection and illumination A common approach to separate the reflection and illumination is based on this assumption ... Comparison of the proposed SVD based equalization with standard Histogram Equalization (HE) on the final recognition rates, where there are poses in the training set Equalization methods SVD Based...
  • 10
  • 303
  • 0
Báo cáo hóa học: " Research Article Human Gait Recognition Based on Multiview Gait Sequences" doc

Báo cáo hóa học: " Research Article Human Gait Recognition Based on Multiview Gait Sequences" doc

Ngày tải lên : 21/06/2014, 22:20
... The maximization of the above quality is reminiscent of the optimization problem that appears in two-class linear discriminant analysis Trivially, the ratio can be maximized by determining a vector ... investigated the exploitation of the availability of various views in a gait recognition system using the MoBo database We showed that each view has unequal discrimination power and therefore has ... [11] A Kale, A K R Chowdhury, and R Chellappa, “Towards a view invariant gait recognition algorithm,” in Proceedings of IEEE Conference on Advanced Video and Signal Based Surveillance (AVSS ’03),...
  • 8
  • 241
  • 0
Báo cáo hóa học: " Synthesis of High Coercivity Core–Shell Nanorods Based on Nickel and Cobalt and Their Magnetic Properties" pot

Báo cáo hóa học: " Synthesis of High Coercivity Core–Shell Nanorods Based on Nickel and Cobalt and Their Magnetic Properties" pot

Ngày tải lên : 22/06/2014, 00:20
... contribution in modifying the magnetic properties because of its high uniaxial anisotropy However, this is more true in the bulk and the magnetic interactions taking place at the interface at Ni ... Magnetic studies showed that Ni @ Co nanorods exhibited high longitudinal coercivity, and they can find applications in various fields where high coercivity is required Understanding the growth mechanism ... interrod interaction This type of hybrid magnetic system with higher aspect ratio can render very high coercivity with the higher contribution of shape anisotropy and higher coercivity hybrid nanorods...
  • 5
  • 405
  • 0

Xem thêm