ata and integrated disk electronics ide
Tài liệu Using Samba-5. Browsing and Advanced Disk Shares-P1 pptx
... prevent the [data] share from the previous chapter from being visible, we could write: [data] path = /home/samba/data browseable = no guest ok = yes comment = Data Drive volume = Sample-Data-Drive ... /var/log/samba.log.%m max log size = 50 debug timestamp = yes [data] path = /home/samba/data browseable = yes guest ok = yes comment = Data Drive volume = Sample-Data-Drive writable = yes However, what if we didn't ... list and the server that maintains it is called the local master browser As machines come on and off the network, the local master browser continually updates the information in the browse list and...
- 30
- 412
- 0
Tài liệu Using Samba-5. Browsing and Advanced Disk Shares-P2 pdf
... outside the current share tree If we create a file outside the share (for example, in someone's home directory) and then create a link to it in the share as follows: ln -s ~tom/datafile /datafile ... have read, write, and execute bits for three classifications of users: owner, group, and world These permissions can be seen at the extreme left-hand side when a ls -al command is issued in a ... set the Unix user and group attributes of a file that is created on the Windows side, you can use the force user and force group options For example: [data] path = /home/samba/data browseable =...
- 30
- 318
- 0
Tài liệu Using Samba-5. Browsing and Advanced Disk Shares-P3 docx
... accidentally deleted a file which they had set read-only In fact, even the Unix rm command will ask users if they really want to override the protection and delete read-only files It's a good idea ... oplocks and could easily ride roughshod over a lock Some Unix systems have been enhanced to understand the Windows oplocks maintained by Samba Currently the support exists only in SGI Irix 6.5.2f and ... upper-case characters, followed by a dot, and three more uppercase characters This was known as the 8.3 format, and was a huge nuisance Windows 95/98, Windows NT, and Unix have since relaxed this problem...
- 30
- 367
- 0
COMMON LICE AND MITES OF POULTRY: IDENTIFICATION AND TREATMENT docx
... and 2 Eggclustersofthechickenbodylouseonbaseofventfeathers.Eacheggislessthan1mmlong.Photosby NancyHinkle,UniversityofGeorgia(Figure1) and BradMullens,UCRiverside(Figure2) ... scaleshowsthisunfedmitetobeslightlylessthan1mmlong.PhotobyJeb Owen,UCRiverside Northernfowlmitesfeedingonpoultry.PhotobyBradMullens,UC Riverside Featherblackening and scabbing,aresult offeedingbynorthern ... fowlmites.Photosby BradMullens,UCRiverside (Figure5) and Nancy Hinkle,Universityof Georgia(Figure6) ISBN 978-1-60107-331-0 and 2 Eggclustersofthechickenbodylouseonbaseofventfeathers.Eacheggislessthan1mmlong.PhotosbyNancyHinkle,...
- 7
- 348
- 0
EDWIN LUTYENS AND NEW DELHI - AN IDEAL GARDEN CITY ppt
... at buildings and townscapes by Lutyens, Baker and the whole team of architects including included J A Brodie, G S C Swinton, and R T Russell (who designed more than 4,000 residences and civic buildings ... consultant and resource before and during The Tour • Candia Lutyens accompanying The Tour • The services of Quo Vadis Travel’s representatives and local English-speaking professional guides throughout ... SIGHTSEEING: Entrance and still camera fees to all monuments and museums visited during tour sightseeing • All tips to drivers, bell hops, guides; and to porters at airports, hotels, boats and railway...
- 6
- 387
- 0
Báo cáo khoa học: Mammalian glutaminyl cyclases and their isoenzymes have identical enzymatic characteristics docx
... CACAGCGAGAATGCGGGCCAAGTTGTGTACCGT ATATGAATTCTTCTACACCATTTGGAGC ATATATGCGGCCGCCTAGTGATGGTGATGGTGATGGAGCCCCAGGTATTCAGCCAG ATATGAATTCCATCACCATCACCATCACTTCTACACCATTTGGAGCGGC ATATATGCGGCCGCCTAGAGCCCCAGGTATTCAGC ATATGAATTCCATCACCATCACCATCACGAGGAGCTGCCGCTGGGCCG ... of these data resulted in pKa values of 9.5 ± 0.3 and 8.2 ± 0.4 for murine isoQC and 9.0 ± 0.2 and 8.3 ± 0.3 for murine QC Apparently, all dissociating groups, which influence the catalytic process ... catalytic process in QC and isoQC, are conserved, supporting an identical catalytic mechanism Characterization of metal dependence and structural elements The animal QCs and isoQCs share a structural...
- 15
- 284
- 0
Local Government, Gender and Integrated Development Planning docx
... Todes, Urban, Rural and Economic Development, HSRC Pearl Sithole, Democracy and Governance, HSRC Amanda Williamson, School of Architecture and Planning, University of the Witwatersrand v Commission ... KwaZuluNatal Department of Local Government and Traditional Affairs funded the provincial workshop, while the three municipalities provided venues for the workshops The Department of Provincial and ... underlying research, and co-funded the workshops and this publication The European Union’s Conference, Workshop and Cultural Initiative (CWCI) co-funded the publication and the workshops linked...
- 6
- 335
- 0
ComputerTechniques Computer Hided and Integrated Manufacturing SystemsII S-Volume SelCornelius ppt
... Garden, London WC2H 9HE British Library Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library COMPUTER AIDED AND INTEGRATED MANUFACTURING SYSTEMS A ... components and their layout 21,22 Besides modeling structural, behavioral and functional aspects of the product, graph and trees have also been used to model requirements and constraints 23 Kusiak and ... experience and examples presented to it If inadequate data is provided, generalization will be difficult and the network response to unknown data, poor However, if too many training patterns are provided,...
- 248
- 152
- 0
Computer Aided Manufacturing (CAD/CAM)Computer Hided and Integrated potx
... Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library COMPUTER AIDED AND INTEGRATED MANUFACTURING SYSTEMS A 5-Volume Set Volume 4: Computer Aided ... with three vertices and a normal, which identifies which side faces out and which side faces in In the STL file, solid models are represented as an unordered collection of facets and each facet has ... methods of computer aided and integrated manufacturing systems have produced and will, no doubt, continue to produce significant annual improvement in productivity — the goods and services produced...
- 313
- 253
- 0
transistor circuit techniques discrete and integrated
... package Integrated circuits An integrated, or monolithic, circuit is a small chip of silicon (typically between mm and mm square and 0.25 mm thick) containing hundreds of thousands of components and ... scale) The oxide layer and metallization have been omitted 21 Text © G.J.Ritchie 1983, 1987, 1993 Millman and Grabel (1987), pp 191–193 provide more information on integrated diodes Integrated ... current gain BJT characteristics Load line BJT ratings Integrated circuits The planar process Integrated BJTs Integrated diodes Integrated resistors Integrated capacitors Economic forces Summary Problems...
- 233
- 671
- 0
reasons of identity a normative guide to the political and legal assessment of identity claims nov 2009
... interpreting and assessing identity claims developed in this book It examines the meaning and ambiguities of identity in political and scholarly debates, and the widely held position that identity and identity ... of identity claims and showed how considerations of institutional humility and respect for persons provide justice-based reasons for taking identity seriously The challenge now is to explain and ... respectively Chapter identiWes two broad theoretical responses to identity claiming that provide important challenges to my approach I label these responses ‘identity quietism’ and ‘identity scepticism’...
- 197
- 386
- 0
social and psychological bases of ideology and system justification mar 2009
... Social and Psychological Bases of Ideology and System Justification between the contents of conservative ideology, which they identified as resistance to change and acceptance of inequality, and heightened ... Scott Eidelman and Christian S Crandall / 85 Belief in a Just World, Perceived Fairness, and Justification of the Status Quo / 107 Carolyn L Hafer and Becky L Choma Disentangling Reasons and Rationalizations: ... in Social and Psychological Bases of Ideology and System Justification Over the past three decades, the cognitive and brain sciences have utterly changed our understanding of the mind and how it...
- 548
- 189
- 0
SOIL FERTILITY IMPROVEMENT AND INTEGRATED NUTRIENT MANAGEMENT – A GLOBAL PERSPECTIVE docx
... techniques, the 31P NMR solution and the synchrotron-based techniques can provide insights into P chemistry and forms in soil and 30 Soil Fertility Improvement and Integrated Nutrient Management ... inorganic and organic fertilizers, often applied together due to their synergistic and positive impacts on plant nutrition and soil food-web organisms Soil Fertility Improvement and Integrated ... 1) Land clearing for establishment of crops and pastures; 2) Timber and firewood extraction; 3) Forest fires; 4) Unfortunate silvicultural treatments and, 5) Massive reforestation with pine and...
- 318
- 424
- 0
Báo cáo sinh học: " Hide and seek: the secret identity of the phosphatidylserine receptor" pps
... occurring in vivo in a wide variety of cell types [3,4] and in both vertebrate and invertebrate organisms [5] The ready conclusion is that PS has something to with apoptotic cells identifying themselves ... Lengeling and colleagues also document that deletion of this gene causes “perinatal lethality, growth retardation and a delay in the terminal differentiation of kidney, intestine, liver, and lungs ... knockout and wild-type animals The second report of a knockout of this gene in mice appeared earlier this year [15], and this study noted severe developmental defects in definitive erythropoietic and...
- 4
- 289
- 0
Báo cáo toán học: "The q-Binomial Theorem and two Symmetric q-Identities" doc
... which is symmetric in a and b Note that the special case z = of (1.2) has also appeared in the literature (see Stockhofe [9] and Pak [8, 2.2.4]) Rewrite the left-hand side of (1.3) as (z; q)n ... Replacing q and a by q and −aq, respectively, (1.3) becomes ∞ n=0 (−aq; q )n n (−aqz; q )∞ z = (q ; q 2)n (z; q )∞ (3.1) It is easy to see that the coefficient of z n on the left-hand side of (3.1) ... on the right-hand side is equal to q |µ| aodd(µ) µ∈P1 (µ)≤n The proof then follows from the involution σ in the proof of Theorem 2.1 Proof of Theorem 1.2 Replacing q and z by q and −zq, respectively,...
- 8
- 313
- 0
Báo cáo khoa học: " Comparison of CT and integrated PET-CT based radiation therapy planning in patients with malignant pleural mesothelioma" pot
... (BP and checked by ET) with specific experience in MPM cancer treatment on the CT and integrated PET-CT images The GTV was defined as the volume of macroscopic primary tumor and involved hilar and ... margin, and PTV2 was created with a 1-cm margin to the GTV All volumes were defined again on integrated PET-CT images Lungs (right and left separately), liver, heart, esophagus, and kidneys (right and ... present study, we compared CTbased and integrated PET-CT-based gross tumor volume (GTV) delineation and its subsequent expansion to clinical target volume (CTV) and planning target volume (PTV)...
- 7
- 362
- 0
Combining global genome and transcriptome approaches to identify the candidate genes of small-effect quantitative trait loci in collagen-induced arthritis pptx
... 2, 1, and potential candidate genes within the confidence intervals of loci 1, 2, 3, 5, and 8, respectively, while no candidate gene was identified for loci and Table summarises the 21 candidate ... relatively high P values and overlap with previously-identified arthritis QTL The second approach is investigating candidate genes using both mouse and human studies Candidate genes will be selected ... genes inside them, we investigated CIA genetically susceptible and resistant strains at both the genome and transcriptome levels At the genome level, F2 progeny of the CIA susceptible (DBA/1) and...
- 9
- 317
- 0
báo cáo khoa học: " Systems medicine and integrated care to combat chronic noncommunicable diseases" docx
... heterogeneous data, including clinical data, and provide tools for the management, search and sharing of the data Such information needs to accessible, shared between investigators, queried, and integrated ... informatics needs to provide ubiquitous and powerful electronic healthcare record technologies to securely aggregate and handle diverse, complex, and comprehensive data types [68] Biomedical ... oriented primary care can link and reinforce personal and public health efforts [83] To understand, preserve and improve the health of human populations and individuals, an integrated research strategy...
- 12
- 281
- 0
báo cáo khoa học: " New sources of soybean seed meal and oil composition traits identified through TILLING" docx
... The data represents the mean of the ratio of extractable seed sucrose to the sum of raffinose and stachyose Error bars represent plus and minus one standard deviation from the mean The identification ... sucrose and galactinol Stachyose is formed in a stepwise reaction utilizing raffinose and galactinol as substrates Both raffinose and stachyose are indigestible by monogastric animals and are ... mutations did not result in amino acid changes and therefore were not considered candidates for phenotypic characterization The other two lines, designated 165 and 397, contained mutations which resulted...
- 11
- 273
- 0
Báo cáo y học: " Physical and in silico approaches identify DNA-PK in a Tax DNA-damage response interactome" pot
... number of peptides with sequence unique to the protein (unique peptides), the sum of the relevant peptide confidence scores (protein score), the percentage of sequence coverage (coverage) and the relative ... Muthusamy B, Gandhi TK, Chandrika KN, Deshpande N, Suresh S, et al.: Human protein reference database as a discovery resource for proteomics Nucleic Acids Res 2004, 32:D497-501 Brandes U: A faster ... result of such focused research efforts has been thousands of articles and a healthy dose of controversy These qualities also make Tax an ideal candidate for the development of a complete list of...
- 13
- 340
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25