at the crossroads of embryonic stem cells and cancer
Báo cáo khoa học: Epigenetics: the study of embryonic stem cells by restriction landmark genomic scanning pptx
... between ES cells and EG cells, the ED of TS cells to ES cells (77) is greater than that of EG cells to ES cells (49), confirming the similarity of EG cells to ES cells DNA methylation profiles that are ... study of embryonic stem cells TE N Hattori and K Shiota ICM PGC TS cells Placental cells 77 ES cells 49 EG cells Embryonic cells Fig Epigenetic distances between ES cells and other stem cells ... is the establishment of embryonic stem (ES) cells, which maintain the ability to form all types of cells in the body, and can differentiate into a variety of cell types in vitro [8] The use of...
- 7
- 439
- 0
The signals of FGFs on the neurogenesis of embryonic stem cells ppsx
... triplicate inhibitors These results demonstrated that the reduction of neural formation by the inactivation of MAPK was caused by the blockage of ES differentiation, rather than by the enhancement of ... for the neural induction of ES cells Release of pharmacological inhibition re-initiated the ES differentiation and neurogenesis, indicating that the FGF pathway participates in the initiation of ... mES cells and participated in the design of the study CSL, IMC SZL and HLS participated in the design of the study and performed the statistical analysis All authors read and approved the final...
- 11
- 194
- 0
Characterization of the secretion of mesenchymal stem cells and its relevance to cardioprotection
... cell therapy for the heart accounts for one third of the publications in the regenerative medicine field29 The rationale for the use of stem cells to repair cardiac tissues was based on the hypothesis ... with the Guide for the Care and Use of Laboratory Pigs prepared by the Institute of Laboratory Animal Resources and with prior approval by the Animal Experimentation Committee of the Faculty of ... understanding of the cardioprotective mechanism of MSC-based therapy in AMI It clearly demonstrated that cardiac repair could be achieved without the actual participation of the cells themselves...
- 161
- 343
- 0
báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx
... reprogramming at regulatory elements Pluripotent cells are in a state of permanent anticipation of many alternative developmental fates, and this is reflected in the prevalence of the poised promoters and ... those of hESCs and somatic cells [90] That study demonstrated that although the hESC and iPSC DNA methylation landscapes are remarkably similar overall, hundreds of differentially methylated regions ... whether poised enhancers are marked by the same chromatin signature in hESCs, mESCs and differentiated cell types, and evaluate the functional relevance of the Polycombmediated H3K27 methylation...
- 13
- 338
- 0
Báo cáo y học: "Childhood infections and asthma: at the crossroads of the hygiene and Barker hypotheses" docx
... to develop asthma [28] The risk of atopy and asthma is related to failure of the neonate to generate interferon-γ and the resultant failure to transition from the Th2 to the Th1 immunophenotype ... both the in utero and postnatal state (Table 1) One common hypothesis to support this gene by environment interaction in the neonate has been the role of endotoxin and polymorphisms of the CD14 ... expressed in the fetus, has been noted in linkage studies of atopy [18] and asthma [19], and probably explains the familial aggregation pattern of pulmonary function noted within asthmatics [20] Maternal...
- 4
- 300
- 0
Báo cáo y học: "Identification and isolation of embryonic stem cells in reproductive endocrinology: theoretical protocols for conservation of human embryos derived from in vitro fertilization" ppsx
... fertilization, and intracytoplasmic sperm injection For ESC, the debate was vocal and escalated quickly to the highest levels of government In response to the 2005 Presidential State of the Union ... 1981 Landry DW, Zucker HA: Embryonic death and the creation of human embryonic stem cells J Clin Invest 2004, 114:1184-1186 Voullaire L, Slater H, Williamson R, Wilton L: Chromosome analysis of ... system Stem cell research: social and political factors Public sharing of information about the basic science of ESCs has proven to be important, since those who are aware of the stem cell debate...
- 8
- 368
- 0
Thai Literature at the Crossroads of Modernity Advancing a Critique of Neo-liberal Development through the Writings of Khamsing Srinawk and Chart Korbjitti
... during the night because of the medication, the grandfather failed to scare off water buffalo thieves who made off with the family’s most valuable possession After the grandfather tells the family ... institutions that legitimate these values – the sangha and the monarchy – are losing their once revered status in the wake of Westernization and globalization The works of Khamsing and Chart give ... village at the same time a new road is built, opening the small hamlet up to the outside world The mother and father are both overcome by sadness at the loss of their daughter The father traps...
- 132
- 824
- 0
Role of sonic hedgehog signalling in human embryonic stem cells and its neural derivatives
... (Chuang and McMahon, 1999; Jeong and McMahon, 2005), and is part of the negative feedback loop to limit the range of Shh signaling Therefore, these molecules modulate the range and concentration of ... studies have shown that another function of Shh is to promote the proliferation and survival of neuroepithelial cells This was demonstrated when ectopic activation of the pathway via the constitutively ... induces the expression of the transcription factors OCT4 and NANOG that regulate hESC pluripotency and also the genes of the FGF pathway like FGF2 and the receptors FGFR1, and (Xiao et al., 2006) There...
- 178
- 546
- 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 2
... indicative of the propagation of signals downstream of ALK4/5/7 Hence, the elevated phosphoSMAD2(Ser465/467) level indicates that Lefty2 RNAi triggered the activation of signaling mediated by the ... important for the maintenance of the undifferentiated state of the ES cells or regulation of Oct4, Sox2 or Nanog, ablating it by RNAi would reduce the luciferase activity Co-transfection of the OCT4 ... samples and the control Withdrawal of LIF was used in this assay to allow Lefty2 shRNA knockdown to differentiate the ES cells The cells were then dissociated with trypsin and replated at single...
- 117
- 415
- 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 3
... conclusion, the data presented in this thesis lead to the establishment of Lefty2 as an important regulator of embryonic stem cell fate Also, this thesis extends the current understanding of ES cell ... beyond the established roles of LIF/STAT3, BMP and WNT pathways and that of the core transcriptional regulatory circuitry governed by OCT4, SOX2 and NANOG Furthermore, this thesis is the first ... aim of this project hence serves to identify and delineate the roles of additional factors and pathways that are important for the maintenance of ES cell self-renewal To achieve this aim, a candidate...
- 4
- 184
- 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 4
... AGCTTAAAAAGCATCAACGTACCATGTCAtctcttgaaTGACATGGTACGTTGATGCGGG shRNA3 sense GATCCCCGGTGCATGCTGTAGATGTAttcaagagaTACATCTACAGCATGCACCTTTTTA shRNA3 antisense AGCTTAAAAAGGTGCATGCTGTAGATGTAtctcttgaaTACATCTACAGCATGCACCGGG ... AGCTTAAAAAGGATGTGCCTTTCATGCAAtctcttgaaTTGCATGAAAGGCACATCCGGG shRNA3 sense GATCCCCGTAGCCTCATCCCTAAATTttcaagagaAATTTAGGGATGAGGCTACTTTTTA shRNA3 antisense AGCTTAAAAAGTAGCCTCATCCCTAAATTtctcttgaaAATTTAGGGATGAGGCTACGGG ... GATCCCCGTTGTGGATTCCGACATAAttcaagagaTTATGTCGGAATCCACAACTTTTTA shRNA1 antisense AGCTTAAAAAGTTGTGGATTCCGACATAAtctcttgaaTTATGTCGGAATCCACAACGGG shRNA2 sense GATCCCCGGAGGACAACGAAATGAAAttcaagagaTTTCATTTCGTTGTCCTCCTTTTTA...
- 24
- 298
- 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency 5
... human embryonic stem cells and embryonic carcinoma cells Stem Cells 22, 659-668 Matsuda, T., Nakamura, T., Nakao, K., Arai, T., Katsuki, M., Heike, T., and Yokota, T (1999) STAT3 activation is ... implantation depends on maternal expression of leukaemia inhibitory factor Nature 359, 76-79 191 Tabibzadeh, S., and Hemmati-Brivanlou, A (2006) Lefty at the crossroads of "stemness" and differentiative ... Transcriptome profiling of human and murine ESCs identifies divergent paths required to maintain the stem cell state Stem Cells 23, 166-185 Wieduwilt Matthew J., (2003) SMAD3 in embryonic patterning,...
- 13
- 229
- 0
Identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency
... OCT4 and SOX2 are key regulators of ES cell fate These factors are at the top of the hierarchy of the ES cell regulatory network and they keep ES cells undifferentiated by either the activation of ... with the regulation of the growth and self renewal of iPS cells rather than the induction of pluripotency per se, as overexpression of Klf4 and c-Myc resulted in formation of tumour cells that ... strongly in the left lateral plate mesoderm The splanchnic layer that forms the future circulatory system and gut wall originates from the lateral plate mesoderm During later development and adulthood,...
- 41
- 312
- 0
Appendix identification of factors involved in the maintenance of embryonic stem cell self renewal and pluripotency
... Description of Ct method used for tabulation of qPCR data For all the qPCR data presented in this thesis, the relative transcript levels for the Ct method gene of interest between test sample and control ... target in mouse Es cells LeftyB (human Lefty1) is regulated by Wnt pathway High expression in ES cells and ICM Differential expression pattern between ES cells and differentiated cells Co-expressed ... expression pattern between ES cells and differentiated cells Reduced expression during retinoic acid induced differentiation of F9 cells High expression in ES cells Link to canonical Wnt pathway •...
- 12
- 183
- 0
Transcriptome study of human embryonic stem cells and knockdown study of a pluripotency marker, LIN28
... from the other tissues/cell lines regardless of the differentiation stages, Page 38 which indicated the uniqueness of the human ES cells from the rest of the cells, cancerous or normal and that ... AGGAGCTCGCAGGATGGATA CAGAATCATCCACTGACATCAAA GT TTCCTTTGCATTCATCTCTCAA GCCCGAATTCCTTGGTGACT TCACTGCATCCCAATCCATCT ATCAGCTCCACCACCACCTT GTTTCTCTCTGTTTCTGCCATCTG CGTCGATCTCCTTGTGTTCAAG CAGAGAGCACGCGGATGTC ... integration site family Page X Chapter Introduction 1.1 Human embryonic stem cells 1.1.1 Overview and characteristics of human embryonic stem cells Embryonic stem (ES) cells are isolated from the...
- 109
- 371
- 0
differentiation of embryonic stem cells
... Differentiation of Embryonic Stem Cells 13 Gene Targeting Strategies for the Isolation of Hematopoietic and Endothelial Precursors from Differentiated ES Cells 14 Establishment of Multipotent Hematopoietic ... YAMAZAKI, AND SHIN-ICHI HAYASHI 98 v vi TABLE OF CONTENTS Development of Hematopoietic Repopulating Cells from Embryonic Stem Cells The In Vitro Differentiation of Mouse Embryonic Stem Cells into ... Differentiation of Mouse Embryonic Stem Cells Early Commitment Steps and Generation of Chimeric Mice Lineage Specific Differentiation of Mouse ES Cells: Formation and Differentiation of Early Primitive...
- 574
- 619
- 0
Báo cáo khoa học: "Human embryonic stem cells and therapeutic cloning" pdf
... trails that employ adult stem cells (such as blood-forming hematopoietic stem cells and cartilage-forming cells) A potential advantage of using adult stem cells is that the patient's own cells could ... all the somatic cell genes and activating the embryonic ones The reconstructed embryos are induced embryonic developments and ES cells would be isolated from the ICMs of the cloned preimplantation ... performed and demonstrated that the cell line originated from the cloned blastocysts reconstructed from the donor cells, not from parthenogenetic activation The statistical probability that the cells...
- 10
- 403
- 0
báo cáo khoa học: " The HPB-AML-I cell line possesses the properties of mesenchymal stem cells" ppt
... which made them distinct from the undifferentiated cells Inverted microscopic examination demonstrated the presence of a number of vacuoles in the cytoplasm of differentiated HPB-AML-I cells (Figure ... karyotype of the original leukemic cells Therefore, the complex karyotype in HPB-AML-I may not correspond to the cytogenetic status of the primary cells It is possible that the complex karyotype of ... flattened or spindle-like morphology and that the capability of differentiating toward adipocytes of the spindle-like MSCs was superior than that of the flattened cells Since such heterogeneous morphology...
- 9
- 284
- 0
báo cáo khoa học:" Induction of osteogenic markers in differentially treated cultures of embryonic stem cells" ppt
... amplification of the without hematopoeticqualitative marker (c) DAG Results from(b) with BMP-2, or CD34 in ESC cells treated (a) Results from qualitative PCR showing amplification of the hematopoetic ... perform and evaluate the histological investigations, RD, CN, MO, NK and UM participated in its design and coordination and helped to draft the manuscript All authors read and approved the final ... of mineral deposition in unstimulated control cells or cells stimulated with LIF In order to assess the differentiation of ESCs cultured under different conditions, we used the hematopoetic stem...
- 7
- 397
- 0
Báo cáo y học: "Obstructive apneas induce early activation of mesenchymal stem cells and enhancement of endothelial wound healing" ppsx
... activation of MSC: specifically, an increase in the mobility of these stem cells and in their adhesion to endothelial cells Moreover, it was also found that the serum of apneic rats improved endothelial ... 7.6.1.0 software) The number of cells that migrated to the lower side of the membrane was counted by means of light microscopy, operated by an investigator who was blind to the types of sera present ... OSA modulates basic mechanisms in the response to inflammation and endothelial damage: MSC migration and adhesion to endothelial cells and endothelial wound healing Methods Application of recurrent...
- 7
- 282
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25