assembling your team members and knowing when to use them

Báo cáo y học: "introduction to special issue on Eye and Zoonosis – from the guest editors"

Báo cáo y học: "introduction to special issue on Eye and Zoonosis – from the guest editors"

... of acquired and congenital infections in presumed ocular toxoplasmosis Am J Ophthalmol 2008;146:851-5) • Optical Coherence Tomography in ocular toxoplasmosis • Usefulness of vitrectomy in the ... ocular toxoplasmosis • Update on the treatment of ocular toxoplasmosis We hope that this special issue will be interesting to readers and provides researchers with timely update on various topics...

Ngày tải lên: 03/11/2012, 11:11

2 617 0
Silychristin and isosilychristin from the fruits

Silychristin and isosilychristin from the fruits

... cultivated in the North of Vietnam This compound also was reported to be inhibitor of horseradish peroxidases and lipoxygenase and antihepatotoxic agent [5] Compound was obtained as yellow crystals from ... two doublets at H 5.85 and 5.90 ppm (J = 1.5 Hz), two doublets at H 6.82 and 6.87 ppm, three other aromatic protons at H 6.79 (d, J = 8.0 Hz), 6.81 (dd, J = 8.0, 1.0 Hz) and 6.99 (d, J = 1.0 Hz) ... HMBC of and Acknowledgements: The authors wish to thank Mr Dang Vu Luong, the NMR Lab., Institute of Chemistry, Vietnamese Academy of Science and Technology for recording the NMR spectrum, and Dr...

Ngày tải lên: 07/11/2012, 15:53

5 408 0
Tài liệu Unix Use and Security From The Ground Up_ The Prophet pdf

Tài liệu Unix Use and Security From The Ground Up_ The Prophet pdf

... command used to move from one directory to another To go to a directory directly below your current directory, type "cd " To move up to the directory directly above your current directory, ... shell), and then drop back into your normal shell Then send him a write message like: I'm going to format your winchesters When he uses the su command to go to the superuser account to kick you ... user to save and delete files in this directory execute -If a user has execute access to a directory, he can go to that directory with the cd command If he also has read permission to that directory,...

Ngày tải lên: 21/12/2013, 04:19

50 551 0
12 Powerful Ideas On Creativity and Business From The PSFK Conference

12 Powerful Ideas On Creativity and Business From The PSFK Conference

... for brands to embrace and proactively share their “story of the maker.” In a world where people long for that human connection, taking them behind the scenes (as brands like Rawley Denim and Etsy ... us to become healthier by tracking our own habits and getting rewarded for it As health costs soar and awareness of healthy (and unhealthy) behaviour rises, tools like this have the potential to ... see and image and want to know more – that is the ultimate goal I can’t change your mind – only you can change your mind (Eric Corey Reed) This relatively quick point was part of a fast and furious...

Ngày tải lên: 09/02/2014, 20:13

5 310 0
Tài liệu People Make the City,’’ Executive Summary - Joint Urban Operations Observations and Insights from Afghanistan and Iraq pdf

Tài liệu People Make the City,’’ Executive Summary - Joint Urban Operations Observations and Insights from Afghanistan and Iraq pdf

... his hand that someone had given to him He called out to me: “Give Me!” I put my hand out the window to wave He must have thought I was going to throw him something and he began to leap into the ... just going to stay and die He’s going to other things to survive.”2 Urban operations training must also vary in condition The situation changes not only from city to city and town to town in terms ... study is to reveal tools that will better enable military and civilian alike to best meet national policy objectives by more effectively conducting urban combat and restoration To so, RAND’s Urban...

Ngày tải lên: 17/02/2014, 23:20

86 409 0
Tài liệu Báo cáo khoa học: Restricted localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase at the neuromuscular junctions – contribution and expression from motor neurons doc

Tài liệu Báo cáo khoa học: Restricted localization of proline-rich membrane anchor (PRiMA) of globular form acetylcholinesterase at the neuromuscular junctions – contribution and expression from motor neurons doc

... (Den) corresponding to PRiMA (top) and AChET (bottom) were determined by PCR and normalized to those of control (sham-operated) muscles (B) Samples of extracts from control and denervated muscles ... yet to be determined Presence of PRiMA-linked G4 AChE in motor neurons At NMJs, AChE may originate from the muscle fiber and ⁄ or from the motor neuron In order to examine the presence of PRiMA and ... for mouse PRiMA I and II (GenBank numbers NM 133364 and NM 178023); 5¢-CTGGGGTGCGGA TCGGTGTACCCC-3¢ and 5¢-TCACAGGTCTGAGCAG CGTTCCTG-3¢ for mouse AChET [30]; 5¢-TGTGATGC CCTTAGATGTCC-3¢ and 5¢-GATAGTCAAGTTCGAC...

Ngày tải lên: 18/02/2014, 08:20

12 488 0
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

... Glu8 to Gln Glu8 to Ala Leu11, Val12 and Phe13 to Gly Val12 to Pro Gly21 to Ala Pro22 to Gly Pro22 to Leu Leu25 to Ala Pro26 to Ala Leu63 to Ala Arg37 and Arg40 to Asn Lys64, Lys65 and Lys68 to ... ggtgcgtcgatccaaggctttcaacaagcaatgag Gly2 to Ala Tyr7, Glu8 and Leu9 to Pro Ile12 to Pro Val16, Val17 and Leu18 to Gly Phe20 to Ala Gly21 to Ala Lys24 to Ala Leu25 to Ala Gly33 to Ala Phe39 to Ala Lys37, Lys40 and Lys41 to Gln ... cccgatgtactgtgcgtttgaaatcggtgtcttc Pro48 to Ala Ile81 to Met Pro85 to Ala Phe94 to Ala Pro97 to Ala Leu99 to Ala Glu103 to Gln Glu103 to Ala Arg104 to Ala Arg105 to Ala Phe118 to Ala Gly121 to Ala Tyr154 to Ser Phe169 to Ala...

Ngày tải lên: 19/02/2014, 17:20

15 532 0
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

... synthesized and used together with the primer ccNiR_Cterm, 5¢-TCYTGICCYTCCCASACYT GYTC-3¢, already used in nrfA isolation [17] to amplify by PCR a 2000 bp DNA fragment comprising nrfH and nrfA partial ... observed in cytochrome c3 superfamily, and if the crystal structures of either cytochrome c3 or cytochrome c7 could be used for modelling However, no significant similarity between NrfH and c3 primary ... NrfA to one NrfH subunits According to this stoichiometry, each NrfA heme corresponds to 14% of the total iron absorption, and each NrfH heme corresponds to 7% From previous EPR studies [23],...

Ngày tải lên: 21/02/2014, 00:20

12 594 0
AKBAR, EMPEROR OF INDIA A PICTURE OF LIFE AND CUSTOMS FROM THE SIXTEENTH CENTURY ppt

AKBAR, EMPEROR OF INDIA A PICTURE OF LIFE AND CUSTOMS FROM THE SIXTEENTH CENTURY ppt

... still stands to- day His generosity and clemency were also shown in the fact that he extended complete pardon to the accomplices in the murder of the grand vizier and even permitted them to retain ... opposed to Akbar's inmost conviction He had climbed far enough up the stony path toward truth to recognize all religions as historically developed and as the products of their time and the land of ... their offices and dignities because he was convinced that they had been drawn into the crime by the violent Adham Chân In other ways too Akbar showed himself to be ready to grant pardon to an almost...

Ngày tải lên: 06/03/2014, 12:20

38 673 1
Next Generation Connectivity: A review of broadband Internet transitions and policy from around the world pdf

Next Generation Connectivity: A review of broadband Internet transitions and policy from around the world pdf

... from 7th to 1st place, nudging Denmark and the Netherlands from first and second to second and third places, and Finland and South Korea switch places from the bottom of the first to the top of ... the top eight slots The top six, or top quintile, includes Denmark, Norway, and Iceland, as well as the Netherlands, Switzerland, and South Korea The second quintile includes, in addition to Sweden ... in broadband Open access policies seek to make it easier for new competitors to enter and compete in broadband markets by requiring existing carriers to lease access to their networks to their...

Ngày tải lên: 06/03/2014, 21:20

232 669 0
Báo cáo khoa học: The fabp4 gene of zebrafish (Danio rerio) ) genomic homology with the mammalian FABP4 and divergence from the zebrafish fabp3 in developmental expression pot

Báo cáo khoa học: The fabp4 gene of zebrafish (Danio rerio) ) genomic homology with the mammalian FABP4 and divergence from the zebrafish fabp3 in developmental expression pot

... and FABP4 show additional similarities in their tertiary structures, related to their ligand-binding specificity and affinity [10] In addition to the similar threedimensional structure and ligand-binding ... (chromosomes and 8, respectively) [29,30], mouse (chromosomes and 3, respectively) [31,32] and rat (chromosomes and 2, respectively) [33,34] We assigned both fabp3 [19] and fabp4, however, to a single ... Cancer, National Institute of Health (to C Thisse and B Thisse), and Izaak Walton Killam Memorial Scholarships (to M K Sharma and R.-Z Liu) We thank Aline Lux and Vincent Heyer for help with whole...

Ngày tải lên: 07/03/2014, 10:20

13 478 0
SCULPTURE AND INSCRIPTIONS FROM THE MONUMENTAL ENTRANCE TO THE PALATIAL COMPLEX AT KERKENES DAG, TURKEY pot

SCULPTURE AND INSCRIPTIONS FROM THE MONUMENTAL ENTRANCE TO THE PALATIAL COMPLEX AT KERKENES DAG, TURKEY pot

... BIBLIOGRAPHY Phrygian Source: Notes in the History of Art and Archaeology Art Looking at Greek and Roman Sculpture in Stone: A Guide to Terms, Styles, and Techniques American Journal of Archaeology ... Limestone from Crete and Mainland Greece The Oriental Institute News & Notes Epigrafia greca Anatolian Studies Sculpture from Sardis: The Finds through 1975 The Highlands of Phrygia: Sites and ... Archaic and Classical Periods Die architektonischen Terrakotten Kleinasiens Belleten Die Kunst Anatoliens von Homer bis Alexander The Art of the Hittites The Birth of Greek Art: The Mediterranean and...

Ngày tải lên: 07/03/2014, 13:20

212 333 0
Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

Báo cáo khoa học: Molecular cloning, expression analysis and functional confirmation of ecdysone receptor and ultraspiracle from the Colorado potato beetle Leptinotarsa decemlineata pdf

... (89–95%) Both D and E ⁄ F regions are also highly homologous to those of T molitor and L migratoria (96% and 75%, 88% and 69%, respectively), although they are less homologous to other USPs A ... 6.29 and L migratoria USP showed higher homology to RXR of human and mouse than USP isoforms of dipteran and lepidopteran insects Thus, the functions of USP of L decemlineata, T molitor and L ... Ogura et al referred to as A ⁄ B, C (DNA binding), D, E (ligand binding) and F, which is consistent to other members of the nuclear receptor superfamily Molecular regulatory mechanisms of transcriptional...

Ngày tải lên: 07/03/2014, 21:20

15 564 0
Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx

Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx

... we propose to classify P penneri and into a new Proteus serogroup, O72, as subroups O72a and O72a,72b, respectively, where a is the major, common epitope and b is a particular epitope of P penneri ... of P penneri and In Western blot analysis (Fig 3), P penneri O-antiserum reacted with both the slow and fast migrating bands of the P penneri and LPS, which correspond to high- and low-molecular-mass ... and Bruker DRX-500 spectrometers in D2O at 60 °C using internal acetone (dH 2.225, dC 31.45) as 2D spectra were obtained using standard Bruker software, and XWINNMR 2.1 program (Bruker) was used...

Ngày tải lên: 17/03/2014, 17:20

6 562 0
Marching to Different Drummers: Health Advocacy Groups in Canada and Funding from the Pharmaceutical Industry pptx

Marching to Different Drummers: Health Advocacy Groups in Canada and Funding from the Pharmaceutical Industry pptx

... content And when you look at surveys of physicians, their top request, of course, is for unbranded, “unproduct-specific” information 17 to be provided to them to give to their patients So that when ... that it was important for them to take to their membership, to their constituency 62 The awareness and education campaign evolved into lobbying for funding and education: And I think what happened ... vanguard, “starting to use that power to demand changes, and to ask some tough questions.” If these groups represent an empowered public, how is that power being exercised? What “tough questions”...

Ngày tải lên: 22/03/2014, 11:20

24 344 0
Báo cáo khoa học: Identification, cloning and characterization of two thioredoxin h isoforms, HvTrxh1 and HvTrxh2, from the barley seed proteome pot

Báo cáo khoa học: Identification, cloning and characterization of two thioredoxin h isoforms, HvTrxh1 and HvTrxh2, from the barley seed proteome pot

... from pCR-h1 and pCR-h2 by digestion with Nde1 and BamHI and ligated into the pET11a expression vector linearized with Nde1 and BamHI, to give pETHvTrxh1 and pETHvTrxh2, respectively The sequences ... was used to analyse tryptic peptides The m/z software (Proteometrics, New York, NY, USA) was used to analyse spectra Spectra were calibrated using trypsin autolysis products (m/z 842.51 and m/z ... after the stop codon of HvTrxh2 The resulting PCR product was cloned into pCR Blunt II TOPO (Invitrogen) to give pCR-h2 Construction of expression vectors Inserts were isolated from pCR-h1 and pCR-h2...

Ngày tải lên: 23/03/2014, 17:22

11 435 0
Báo cáo Y học: Implications of the simultaneous occurrence of hepatic glycolysis from glucose and gluconeogenesis from glycerol pdf

Báo cáo Y học: Implications of the simultaneous occurrence of hepatic glycolysis from glucose and gluconeogenesis from glycerol pdf

... added glucose and infused glycerol separately and in combination Hepatocytes from fasted rats were incubated with either 40 mM glucose or 10 mM glucose, together with 0.12% (w/v) inulin and 10 mU ... sequences from glucose to lactate and from glycerol to glucose are phosphohexose isomerase, aldolase and triose phosphate isomerase These cytoplasmic enzymes are considered to catalyse reactions ... trapping of phosphate in phosphorylated intermediates and are analogous to those brought about by exposure of hepatocytes to high concentrations of fructose [24] The generation of 3H2O from [2-3H]glucose...

Ngày tải lên: 24/03/2014, 03:21

6 328 0
Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt

Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt

... peptide of pPORB and vice versa, and the transit peptides were fused to a reporter protein of mouse It was found that only the isolated transit peptide of PORA bound Pchlide, with a stoichiometry ... standard solvents, a capillary voltage of 3000 V and a cone voltage of 45 V was used With neutral solvents, a capillary voltage of 3500 V and a cone voltage of 35 V was used The two MS chromatograms ... PORA and PORB of barley and POR from pea are homologous, and that Pchlide cannot bind to the PORA transit peptide of pPORA as recently proposed [22] Results Acetylation of the POR protein and...

Ngày tải lên: 30/03/2014, 02:20

8 362 0
w