as a result of

... (2000) Autophagy as a regulated pathway of cellular degradation Science 290, 1717–1721 23 Marzella, L., Ahlberg, J & Glaumann, H (1981) Autophagy, heterophagy, microautophagy and crinophagy as the ... mitochondria have a replicative advantage over normal mitochondria [56,57] Analogous selection for dysfunctional mitochondria may also occur in the case of aging; Wanagat et al recently reported that atrophic ... aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic...

Ngày tải lên: 17/03/2014, 23:20

... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... no MAP band was observed (not shown) Gene and mRNA analyses of MAP1b, MAP2, Tau, and STOP The finding that apparently normal neurites are formed even when CAD cells lack MAP1b, MAP2, Tau, and...

Ngày tải lên: 23/03/2014, 05:22

... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com...

Ngày tải lên: 19/06/2014, 15:20

... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com...

Ngày tải lên: 19/06/2014, 15:20

... often associated with temporal traumas rather than nasal packing [1], but occasionally nasal packing, which can lead to peritubal lymphatic stasis, is a cause of hemotympanum [11] Dysfunction of ... arteriosclerotic vascular diseases are possible systemic factors [5,6] Also regular uptake of anticoagulants can cause spontaneous bilateral hemotympanum [7] The vascular supply of nasal mucosa originates ... topical sprays or dust, inflammatory nasal diseases, septal deformities, tumors and vascular aneurysms can be the local factors [5,6] Coagulation deficits, Osler-Weber-Rendu disease and arteriosclerotic...

Ngày tải lên: 21/06/2014, 07:20

... :2 esahP gnilpmas fo yad emas eht no deyassa dna ,C°02− ni derots erew selpmas amsalp ehT amsalp eht etarapes ot g × 005,1 yletamixorppa ta nim 51 rof degufirtnec saw elpmas hcae ,noitcelloc ... dohtem yassa lacigoloiborcim a gnisu denimreted erew snoitartnecnoc emipefec amsalp ehT o dohtem lacitylanA esahp ni sa demrofrep erew serudecorp gnilpmas eht dna esod emas eht ta ylralucsumartni ... ehT )ASU ,SSPS ;0.2 noisrev( tatsamgiS ,margorp lacitsitats eht gnisu dezylana saw atad eht llA )deliat-owt( tset deriap a gnisu derapmoc erew noitcefni eht retfa dna erofeb deniatbo seulav citenikocamrahp...

Ngày tải lên: 07/08/2014, 18:21

... skin flaps that was managed by aspiration and pressure bandaging She also experienced episodes of serous discharge from the site that was self limiting and was managed by pressure bandaging Case ... tuberculosis, leading to a blockage of lymphatic drainage and resulting in vulval elephantiasis Conclusions Vulval elephantiasis is very rare, and vulval elephantiasis as a consequence of lymph node ... The familial version of lymphedema praecox is known as Meige’s Page of disease Primary lymphedema with onset after 35 years of age is called lymphedema tarda In general, primary lymphedema progresses...

Ngày tải lên: 11/08/2014, 02:22

... Hospital with a 3-day history of abdominal pain, vomiting, absolute constipation and abdominal distension The abdominal pain initially started as a dull generalised discomfort, but later became ... a past medical history of only hypercholesterolaemia http://www.jmedicalcasereports.com/content/1/1/8 tified, the decision was made to perform a diagnostic laparotomy and manage the patient accordingly ... general anaesthesia, a midline laparotomy was performed on the patient On entering the peritoneal cavity, gross distension of the small bowel and collapse of the large bowel was identified The small...

Ngày tải lên: 11/08/2014, 10:23

... than a month She began having regular menstrual cycles again, and was able to maintain her weight at an appropriate level One year after discharge from the hospital, her weight was 53 kg, and ... tomography; DSM IV: Diagnostic and Statistical Manual of Mental Disorders, 4th Edition; GI: gastrointestinal; MRI/MRA: magnetic resonance imaging/ arteriography; NG: nasogastric tube; NJ: nasojejunal ... Medical Case Reports 2009, 3:127 Case presentation We report the case of a 16-year-old Caucasian girl who presented to the emergency department complaining of severe nausea, epigastric pain,...

Ngày tải lên: 11/08/2014, 17:21

... documented as a route of HIV transmission, the details of this case support the conclusion that an assault was very likely the source of infection Additionally, comparison of data from study records and ... prepared the first draft of the article All authors contributed to the design of the study as well to the drafting and revision of the manuscript All authors have approved the final manuscript Acknowledgements ... Smith Foundation for Health Research (MSFHR) Senior Graduate Studentship and a CIHR Doctoral Research Award Dr Kerr is supported by a MSFHR Scholar Award and a CIHR New Investigator Award References...

Ngày tải lên: 13/08/2014, 13:21

Ngày tải lên: 04/10/2012, 10:24

... is in their emphasis It is my belief that in giving the L2 student both as much input and practice as they can reasonably manage, and a strong metalinguistic awareness, we, as teachers give the ... Ireland and Britain One of the most important initial tasks for any teacher is the task of knowing his clients The notion of needs analysis is absolutely central Even with as few details as we ... different constraints, at many different levels, on each occasion that they are called upon, they encourage a unique emphasis on particular combinations of strategies on each occasion In reading, the...

Ngày tải lên: 06/09/2013, 10:10

... (accepting) accepting and negative and neutral expresssions: activation accompanied by in amygdala, evaluation of: hippocampus, Task performance: parahippocampal recognition of gyrus, medial type of emotion ... historically and socially shaped features of human existence as shyness or (the probably not unrelated) social phobia The process that leads to social phobia (and away from it, as in cases of therapeutic ... physical signs with imbalances in autonomic neurotransmission In this formulation, the physical complaints typical of social phobia, are associated with rapid release of catecholamines (noradrenaline,...

Ngày tải lên: 01/11/2013, 08:20

... way as if through the eyes of an observer Again, it is difficult to grasp the meaningfulness of this finding, let alone as evidence of a bias However that may be, this putative ‘‘bias’’ is assigned ... treated as if originating in a scale of equal intervals This violates the basic postulates of the analysis of variance The relevant data should have been properly treated through some form of ... instance of a ‘‘category mistake.’’ According to Ryle (1949) this logical fallacy consists of treating the label for a class of events as if it were a member of that class From this vantage point...

Ngày tải lên: 01/11/2013, 08:20

... definitions aside, I shall now consider how the construct of social skills has been assessed in research Assessment of Social Skills of Social Phobic Individuals As the assessment of social skills had ... value of matching treatment with patients’ patterns of fear Based on extreme responses to a role-play and a ‘‘rationality’’ test, 39 patients were classified as either predominantly behavioral ... consider social phobia not as a breakdown in social ability but as emerging out of a pattern of meaningful actions that constitute a means to an end Although not necessarily abnormal in themselves,...

Ngày tải lên: 01/11/2013, 08:20

... (shy, anxious) behavior by the teacher as well as peer assessment of social behavior (popularity, aggression, and isolation) at school At the age of no association was found between shy and anxious ... appeasement and avoidance of conflict typical of social phobic individuals Parental Alcoholism David et al (1995) found an association between parental alcoholism and phobia (both social and agoraphobia); ... variables such as maternal anxiety and an array of variables indexing temperament Nonetheless, it must be borne in mind that an even greater proportion of infants classified as anxiously attached...

Ngày tải lên: 01/11/2013, 08:20

... (mean age 12) on a social phobia and anxiety inventory for children (SPAI-C) and on a behavioral assessment task This included an interaction with a peer as well as reading aloud in front of an ... the validity of the measures devised to ascertain and quantify social anxiety, as this is most relevant to social phobia Examination of the validity both of the construct and of the methods assessing ... the Nature of Social Phobia? The Measurement of Social Anxiety As we have seen earlier, a variety of meanings are attached to the term anxiety (and fear) This implies that there could be substantive...

Ngày tải lên: 01/11/2013, 08:20

... test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed in turn The class ... for this task must have quite easy language and sung at a low speed such as ‘ whatever will be will be’ To carry out this task, teacher can omit some passage of the song word and then ask students ... years; teachers and researchers believe that motivation plays an important part in the process of acquiring an additional language because motivated students are usually those who participate actively...

Ngày tải lên: 29/01/2014, 10:33

... some of the factors accepted by the Public Health Agency of Canada (PHAC) as determinants of health (PHAC, 2003) PHAC has adopted a conceptual model of health determinants that includes: income and ... maternal race, age, adequacy of prenatal care and medical risks, and congenital malformations, birthweight, gestational age, and small-for-gestational age The study by Gaudino et al (1999) offers ... involvement, in addition to measures of the impacts of father’s absence, has been a necessary step towards a program of research that will uncover the effects of varying qualities and amounts of father’s...

Ngày tải lên: 12/02/2014, 11:20

... but at least acknowledge it as a potential outcome of sexual assault: • An online publication by the UN Office for the Coordination of Humanitarian Affairs lists fistula as one of the physical ... sexually assaulted, which often results in social stigmatization As victims of violent sexual assault, women with traumatic fistula may have sustained additional physical injuries They also face ... Nyagakon was violently raped while eight months pregnant, and besides sustaining a fistula, she lost her baby as a result (Wax, 2003) Cases of women who developed traumatic fistula as a result of...

Ngày tải lên: 12/02/2014, 23:20