aren t we all naturalists in ethics

“We are the maths people, aren’t we?” Young children’s talk in learning mathematics

“We are the maths people, aren’t we?” Young children’s talk in learning mathematics

... determining critical incidents in learning Table shows my contribution to the analysis of the data in the TC Project The main findings of the TC project as reported to the funding body are set ... aimed to add to this existing knowledge Chapter The Talking Counts Project This chapter gives an account of the TC Project to further set the context for the doctoral study but also to set out the ... talked to each other regarding instructions in how to complete a task they often ended up working on the mathematics individually It was within this context that we had approached the TC Project The...

Ngày tải lên: 10/10/2014, 23:18

343 246 0
Báo cáo y học: "Why aren’t we practising homogenized medicine" docx

Báo cáo y học: "Why aren’t we practising homogenized medicine" docx

... audit should, in a non-threatening manner, facilitate recognition and, hopefully, correction of our shortcomings The Dutch offer external peer review ‘visitations’ that can be initiated either ... means of comparing models of care and for future hypothesis generation Competing interests The author declares that they have no competing interests References McIntyre LA, He´bert PC, Fergusson ... an individual patient, what constitutes optimal targets, for example, for blood pressure and tissue perfusion, or ‘best’ treatment, such as the optimal duration of a course of antibiotics? Altruistic,...

Ngày tải lên: 13/08/2014, 08:20

2 206 0
How to Help With Math Homework - When the Answers Aren’t in the Book (A Guide for Students, Families, & Friends) pot

How to Help With Math Homework - When the Answers Aren’t in the Book (A Guide for Students, Families, & Friends) pot

... connect mathematical concepts, ask questions that help students see things in new ways and provide the mathematical terminology that allows us to understand each other It is the student’s job to ... solver Listen to the student read the problem aloud and follow along in the text In order to understand the question, we have to get the words right Ask the student to explain the problem in her ... Let’s get a snack and then think about that one How to Help With Math Homework When The Answers Aren t in the Book Suggested Materials for Math Students The following is a list of materials that...

Ngày tải lên: 31/03/2014, 12:20

12 481 0
Báo cáo khoa học: "WHAT DISCOURSE FEATURES AREN''''T NEEDED IN ON-LINE DIALOGUE" docx

Báo cáo khoa học: "WHAT DISCOURSE FEATURES AREN''''T NEEDED IN ON-LINE DIALOGUE" docx

... their perception of the situation and the audience There are variations in people's skill at this, but all it To the extent that they don 't it, they risk being inappropriate and not getting rewards ... positivist social theory To this extent, computer scientists are recreating social theory, starting from the point that is most amenable to their hopes and needs, and so far lacking the dialectic that ... fact that a computer 6an only satisfy a very limited set of purposes for that person in interaction In fact people know perfectly well many of the things computers can 't for them or to them, things...

Ngày tải lên: 31/03/2014, 17:20

4 253 0
Bài giảng TU CHON T 7 TIET 21 IN NGAY

Bài giảng TU CHON T 7 TIET 21 IN NGAY

... ? Hs trả lời theo chứng minh cách ta có ∧ ∧ cân B2 = C lên tam giác IBC ? Vậy theo C1 câu b ta chứng minh Gv gọi Hs lên bảng trình bày Hs theo dõi nhận x t làm bạn Gv nhận x t khai thác toán ... 3.Củng cố :Lồng vào ti t luyện t p 4.Hướng dẫn nhàø : Ôn t p đònh nghóa t nh ch t tam giác cân, tam giác Cách chứng minh tam giác tam giác cân Bài t p nhà 72; 73; 74; 75; 76 / 107 SBT ... ghi GT , KL HS : lớp vẽ hình , vi t giả thi t , k t luận vào Gv: Muốn so sánh ta làm ACE ABD Gv: quan s t hình vẽ dự đoán k t ? HS : nêu dự đoán Gv: chứng minh dự đoán dó Gv: để chứng minh = ta...

Ngày tải lên: 28/11/2013, 16:11

3 333 0
c.t. jones - step 7 in 7 steps

c.t. jones - step 7 in 7 steps

Ngày tải lên: 11/12/2013, 22:42

468 588 13
Tài liệu Báo cáo khoa học: "SenseLearner: Word Sense Disambiguation for All Words in Unrestricted Text" doc

Tài liệu Báo cáo khoa học: "SenseLearner: Word Sense Disambiguation for All Words in Unrestricted Text" doc

... Sense−tagged texts The input to the disambiguation algorithm consists of raw text The output is a text with word meaning annotations for all open-class words New raw text SenseLearner semantic ... words that appeared at least once in the training corpus The words that are not covered by these models (typically about 10-15% of the words in the test corpus) are assigned with the most frequent ... word#sense Table shows the number of feature vectors constructed in this learning stage for each semantic model To annotate new text, similar vectors are created for all content-words in the raw text...

Ngày tải lên: 20/02/2014, 15:20

4 400 0
IF FOOTBALL’S A RELIGION, WHY DON’T WE HAVE A PRAYER? pptx

IF FOOTBALL’S A RELIGION, WHY DON’T WE HAVE A PRAYER? pptx

... that we ve worked it all week and that on top of that we have contingency plans that are well thought out before the game so that we don t have to make eighteen different adjustments at halftime ... as Allied Van Lines and United Van Lines, stuck in our yard All the coaches had that done to them Today, with talk radio and the Internet, with all the writing and chatting about every single thing ... adamantly as I followed Notre Dame But we took some real head-kickings at Indiana Now we were on the other end of that Instead of seeing my dad sitting at the kitchen table on Saturday night with...

Ngày tải lên: 08/03/2014, 20:20

257 845 0
Routledge Studies in Ethics and Moral Theory pdf

Routledge Studies in Ethics and Moral Theory pdf

... not destroying r at t9 , he cannot ensure the truth of the antecedent; in not destroying r at t9 , it might be the case that r emits the particle at t9 , and then ¬R would be false as well; in this ... every instant of time, there is a proposition that expresses the state of the world at that instant; If p and q are any propositions that express the state of the world at some instants, then the ... determinism that the state of the world at T1 together with the natural laws entails that S does A at T3 … Given the entailment just described, S’s refraining from doing A at T3 cannot be an extension...

Ngày tải lên: 16/03/2014, 04:20

220 391 0
Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx

Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx

... 5¢-CACCCAAGCTT GCCACCATGGAGGTTCAGCTGCAGCAGTCTG-3¢; primer 7, 5¢-GGT GGAGGAGGTTCTGATGTTTTGATGACCCAAACTCCAC-3¢; primer 8, 5¢-CGAATGCGGCCGCCCGTTTGATTTCCAGCTTGGTGC-3¢; primer 9, 5¢-GGTGGAGGAGGTTCTGATGTTGTTCTGACCCAAACTCCACTC-3¢; ... noncoding linker containing an EcoRI site at the 5¢ end of the linker (5¢-AATTCTACAGG TCCTCCTCGCTGATCAGCTTCTGCTCCGAACCTGC-3¢) were annealed and inserted into the NotI ⁄ EcoRI site of all pCAG ⁄ anti-WASP ... CCTCCTCACCGGATCCTCCACCTCCAGAACCACCACCCCC-3¢; primer 13, 5¢-CGTCTCCTCAGGGGGTGGTGGTTCTGGAGGTGGAG GATCCGGTGGAGGAGGTTCT-3¢; primer 14, 5¢-CGTCTCCTCA GGGGGTGGTGGTTCTGGAGGTGGAGGATCCGGTGGAGGAGG TTCT-3¢ In all primers,...

Ngày tải lên: 16/03/2014, 14:20

14 493 0
CROSSING THE FINISH LINE Achieving meaningful health care coverage and access for all children in Colorado ppt

CROSSING THE FINISH LINE Achieving meaningful health care coverage and access for all children in Colorado ppt

... Hospital Colorado) We wish to thank Kate Kalstein of Kate Kalstein Consulting for her work to prepare this report In addition, we express great gratitude to the Colorado Health Institute for their ... Institute showed that an estimated 78,437 of the 134,508 uninsured children at that time were eligible for public insurance benefits, but not participating  39,550 children were estimated to ... Spanish-language telenovela designed to explain health insurance options to viewers within the plot lines of the story It resulted in more than 2,000 calls to a health hotline over the course of the show’s...

Ngày tải lên: 17/03/2014, 17:20

24 359 0
Representation, space and Hollywood Squares: looking at things that aren''''t there anymore docx

Representation, space and Hollywood Squares: looking at things that aren''''t there anymore docx

... directed toward the visual event of the fact presentation while oculomotor coordinates were kept constant in the center of the screen In this way, we attempted to test whether attention in the ... port' In all the following studies then, we are interested in whether or not the participants look signi®cantly more often to the critical port than the other ports Importantly, at the moment in ... square window in the center moved to the four ports of the £ grid This allowed participants to move their eyes to the separate locations and attend to the fact presentation In this way, the tracking...

Ngày tải lên: 30/03/2014, 14:20

27 428 0
van sickle, t. (2001). programming microcontrollers in c (2nd ed.)

van sickle, t. (2001). programming microcontrollers in c (2nd ed.)

... an integer and it expects no arguments The type int preceding the function name indicates that it returns an integer and that no arguments to the function are expected The line following the ... including the new line escape character is enclosed in double quotes These double quotes identify a string, and the string is the argument to the function printf() Note that the statement beginning ... bits A rotate differs from a shift in that the most significant bit will be shifted into the least significant bit during the rotation A shift merely shifts zeros into the least significant bit...

Ngày tải lên: 18/04/2014, 12:27

470 715 1
scientific american   -  2000 07  -  alien civilizations  if they really exist, why aren't they here

scientific american - 2000 07 - alien civilizations if they really exist, why aren't they here

... ATAT C A G G C G C G ATATCTCTC TC G G A G G C G C G ATATC TAT TC G G AT TCTA G A G TCTCT TATCT TCTG C G G C G G A G G C G C G ATAT C G A G G C G C G ATATCTCT TCTCT TATCT TC C G G A CT TATCT TCTC ... enabled researchers to dial up GenBank and dump in their sequence data directly, and the administration of C G C G ATATCTCTCT TA C ATG C G C GTATATG C G TCTTCTTTGTTCTTST A C G AT TCTA G A G G C G ... TCTC G ATG C G G C G C G ATATCTCTCT G C GTATATG C G A C GT T TATCT TC C G G A G G C G C A A C GTA G C A A G ATC CT G ATAT C T C T C T TAT C T T “The race and competition will be who can mine [the...

Ngày tải lên: 12/05/2014, 16:03

97 452 0
moral understandings a feminist study in ethics sep 2007

moral understandings a feminist study in ethics sep 2007

... subject matter of ethics Nor does it tell what kinds of reflection on that subject matter are characteristic or constitutive of ethics The idea that ethics is a “normative” study could mean that ethics ... different projects in ethics that have in common for the most part what they reject At the beginning of the twenty-first century, it seems that the idea of compact, code-like theory has lost altitude, ... students It is my hope that they learn to integrate the questions the book raises and the critical perspective it urges into their broader repertoire in ethics and then that they struggle in creative...

Ngày tải lên: 11/06/2014, 00:22

325 185 0
the ends of solidarity discourse theory in ethics and politics mar 2008

the ends of solidarity discourse theory in ethics and politics mar 2008

... bound together, whether by the facts of their existing needs or their interpretations of their own interests, into definite relations The status of mutual relationships of interdependence seems to ... word solidarity has been welded in the furnace of scientific thought It does not appeal to floating, gliding, sweetly shining, perishing sentiments; it trains the mind, fortifies the character, and ... a dispute that, notwithstanding the Theory of Communicative Action’s many virtues, appears to continue unabated to this moment.1 For the present context, the point I am offering is relatively...

Ngày tải lên: 11/06/2014, 13:21

278 732 0
Báo cáo hóa học: "Blood doping by cobalt. Should we measure cobalt in athletes?" docx

Báo cáo hóa học: "Blood doping by cobalt. Should we measure cobalt in athletes?" docx

... Unfortunately, routine cobalt testing within antidoping controls may result ineffective, due to its pharmacodynamic properties, the little data available on cobalt metabolism in athletes and the ... research on cobalt metabolism in athletes is compelling, along with implementation of effective strategies to unmask this potentially deleterious doping practice Competing interests http://www.occup-med.com/content/1/1/18 ... for antidoping laboratories Then, the little information available so far on cobalt metabolism in athletes hampers the appropriate interpretation of population data and the analysis of potential...

Ngày tải lên: 20/06/2014, 00:20

3 352 0
Men Aren’t Stupid and Nine Other Free Lessons That Will Change Your Life pptx

Men Aren’t Stupid and Nine Other Free Lessons That Will Change Your Life pptx

... fact that we re still here perpetuating the species indicates that it works better than the alternatives It is far better to use them to our advantage to gain what we all want a loving relationship ... on the first date and were married within a matter of months, but I think we all agree that they are definite outliers Most of the time those whirlwinds end in nothing but heartache You need time ... attention to your best attributes Once he’s initiated contact, laughing at his jokes and touching him casually cements the notion that you find him attractive and appreciate his humor and intelligence...

Ngày tải lên: 28/06/2014, 00:20

37 336 0
GA L4 T 28 CKTKN CHI IN

GA L4 T 28 CKTKN CHI IN

... dặn dò - GV nhận x t ti t học Tuần 28 Trường TH số Vinh An Giáo án lớp T n Ti t 138: T m hai số bi t tổng t số hai số A Mục tiêu: - Bi t cách giải t n t m hai số bi t tổng t hai số B Đồ dùng ... vi t sai t để sau vi t tả cho -HS vi t mở + vi t đoạn miêu t phận đồ v t, -M t số HS trình bày -Lớp nhận x t Tuần 28 Trường TH số Vinh An Giáo án lớp T n Ti t 140: Luyện t p (Tr.149) A Mục tiêu: ... vi t đoạn văn - HS nối tiếp đọc đoạn văn trước lớp - Nhận x t, tun dương vi t hay C.Củng cố, dặn dò - Nhận x t ti t học Tuần 28 Trường TH số Vinh An Giáo án lớp Kĩ thu t LẮP CÁI ĐU (TT) I MỤC TIÊU...

Ngày tải lên: 05/07/2014, 10:00

20 301 0
w